BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8228841.2.1
(621 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CV271360.1|CV271360 WS0154.B21_H21 PTxN-IB-A-6 Populus t... 40 0.098
gb|CB240517.1|CB240517 PopSC00546 Poplar SC cDNA library Po... 38 0.39
>gb|CV271360.1|CV271360 WS0154.B21_H21 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0154_H21 3', mRNA sequence
Length = 834
Score = 40.1 bits (20), Expect = 0.098
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 523 ttgtttgtaaaataaattaa 542
||||||||||||||||||||
Sbjct: 186 ttgtttgtaaaataaattaa 167
>gb|CB240517.1|CB240517 PopSC00546 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PopSC00546, mRNA sequence
Length = 481
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 554 ttgtggaaagtaaaattaa 572
|||||||||||||||||||
Sbjct: 360 ttgtggaaagtaaaattaa 342
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 60,745
Number of Sequences: 369679
Number of extensions: 60745
Number of successful extensions: 17397
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17395
Number of HSP's gapped (non-prelim): 2
length of query: 621
length of database: 203,408,664
effective HSP length: 19
effective length of query: 602
effective length of database: 196,384,763
effective search space: 118223627326
effective search space used: 118223627326
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)