BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 5705280.3.1
(980 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BI125680.1|BI125680 I064P51P Populus leaf cDNA library P... 38 0.62
gb|BU815977.1|BU815977 N058E08 Populus bark cDNA library Po... 38 0.62
gb|BU889171.1|BU889171 P017E11 Populus petioles cDNA librar... 38 0.62
gb|BU894835.1|BU894835 X015G06 Populus wood cDNA library Po... 38 0.62
gb|CF230756.1|CF230756 PtaC0012F4F0412 Poplar cDNA library ... 38 0.62
gb|CF234473.1|CF234473 Ptajxojxo3A5A0501 Poplar cDNA librar... 38 0.62
gb|CF234696.1|CF234696 PtaJXT0014A8A0802 Poplar cDNA librar... 38 0.62
gb|CV229489.1|CV229489 WS01913.B21_H14 PT-DX-N-A-10 Populus... 38 0.62
gb|CV235704.1|CV235704 WS01221.B21_E03 PT-GT-FL-A-3 Populus... 38 0.62
gb|CV271893.1|CV271893 WS0155.B21_P15 PTxN-IB-A-6 Populus t... 38 0.62
gb|BP926141.1|BP926141 BP926141 full-length enriched poplar... 38 0.62
gb|DT479855.1|DT479855 WS02527.BR_C20 PT-MB-N-A-15 Populus ... 38 0.62
gb|DT485058.1|DT485058 WS02527.B21_C20 PT-MB-N-A-15 Populus... 38 0.62
gb|DT488344.1|DT488344 WS02536.B21_C20 PT-MB-N-A-15 Populus... 38 0.62
gb|DT499078.1|DT499078 WS0117.BR_D18 PT-P-FL-A-2 Populus tr... 38 0.62
gb|DT518803.1|DT518803 WS02439.B21_F04 PTxD-ICC-N-A-14 Popu... 38 0.62
emb|AJ698930.1| Populus euramericana partial mRNA for putat... 38 0.62
gb|DV465634.1|DV465634 MTUNUL1.P41.B04 NUL Populus fremonti... 36 2.4
gb|BI122268.1|BI122268 I004P48P Populus leaf cDNA library P... 34 9.6
gb|BU809266.1|BU809266 UL55PG06 Populus leaf cDNA library P... 34 9.6
gb|BU828161.1|BU828161 K017P61P Populus apical shoot cDNA l... 34 9.6
gb|BU835036.1|BU835036 T068G05 Populus apical shoot cDNA li... 34 9.6
gb|BU870907.1|BU870907 Q019G06 Populus flower cDNA library ... 34 9.6
gb|BU884995.1|BU884995 R019B06 Populus root cDNA library Po... 34 9.6
gb|BU891656.1|BU891656 P053D11 Populus petioles cDNA librar... 34 9.6
gb|BU895372.1|BU895372 X023B09 Populus wood cDNA library Po... 34 9.6
gb|CF233685.1|CF233685 PtaJXO0026E10E1010 Poplar cDNA libra... 34 9.6
gb|CK093919.1|CK093919 I004P48.3pR Populus senescing leaves... 34 9.6
gb|CK097701.1|CK097701 UB59CPA09.3pR Populus active cambium... 34 9.6
gb|CK101751.1|CK101751 F115P74.5pR Populus flower cDNA libr... 34 9.6
gb|CK102281.1|CK102281 G071P82.5pR Populus tension wood cDN... 34 9.6
gb|CK107009.1|CK107009 UB43DPB11.5pR Populus active cambium... 34 9.6
gb|CK116907.1|CK116907 B019P62 Hybrid aspen plasmid library... 34 9.6
gb|CN519205.1|CN519205 GQ0104.B3_M20 GQ010 Populus trichoca... 34 9.6
gb|AJ776654.1|AJ776654 AJ776654 Populus euphratica root 3-6... 34 9.6
gb|CV225831.1|CV225831 WS0162.B21_I09 PT-DX-A-7 Populus tri... 34 9.6
gb|CV226365.1|CV226365 WS0164.B21_A23 PT-DX-A-7 Populus tri... 34 9.6
gb|CV227020.1|CV227020 WS0165.B21_P11 PT-DX-A-7 Populus tri... 34 9.6
gb|CV227933.1|CV227933 WS0168.B21_K03 PT-DX-A-7 Populus tri... 34 9.6
gb|CV229132.1|CV229132 WS01912.B21_F02 PT-DX-N-A-10 Populus... 34 9.6
gb|CV229353.1|CV229353 WS01913.B21_A16 PT-DX-N-A-10 Populus... 34 9.6
gb|CV240266.1|CV240266 WS0234.B21_O16 PT-MB-A-13 Populus tr... 34 9.6
gb|CV240657.1|CV240657 WS0251.B21_P19 PT-MB-N-A-15 Populus ... 34 9.6
gb|CV243650.1|CV243650 WS0252.B21_H18 PT-MB-N-A-15 Populus ... 34 9.6
gb|CV248474.1|CV248474 WS01120.B21_O07 PT-P-FL-A-2 Populus ... 34 9.6
gb|CV254420.1|CV254420 WS0241.B21_C23 PTxD-ICC-N-A-14 Popul... 34 9.6
gb|CV255916.1|CV255916 WS0242.B21_G14 PTxD-ICC-N-A-14 Popul... 34 9.6
gb|CV258964.1|CV258964 WS0201.B21_P21 PTxN-IB-N-A-11 Populu... 34 9.6
gb|CV260639.1|CV260639 WS02014.B21_J20 PTxN-IB-N-A-11 Popul... 34 9.6
gb|CV268614.1|CV268614 WS0205.B21_P15 PTxN-IB-N-A-11 Populu... 34 9.6
gb|CV734581.1|CV734581 F00D02 two-month-old leaves from clo... 34 9.6
gb|CX169561.1|CX169561 G10_69-109_14.ab1 leaf inoculated wi... 34 9.6
gb|CX170183.1|CX170183 G11_69-99_13.ab1 leaf inoculated wit... 34 9.6
gb|CX170883.1|CX170883 B07_69-93_03.ab1 leaf inoculated wit... 34 9.6
gb|CX171680.1|CX171680 C01_69-18_05.ab1 leaf inoculated wit... 34 9.6
gb|CX172617.1|CX172617 G01_69-75_13.ab1 leaf inoculated wit... 34 9.6
gb|CX174443.1|CX174443 E01_69-53_09.ab1 leaf inoculated wit... 34 9.6
gb|CX176035.1|CX176035 F09_69-67_11.ab1 leaf inoculated wit... 34 9.6
gb|CX177762.1|CX177762 G08_45-72_14.ab1 leaf inoculated wit... 34 9.6
gb|CX178363.1|CX178363 E02_45-15_10.ab1 leaf inoculated wit... 34 9.6
gb|CX178397.1|CX178397 D08_45-108_08.ab1 leaf inoculated wi... 34 9.6
gb|CX181005.1|CX181005 G12_45-69_14.ab1 leaf inoculated wit... 34 9.6
gb|CX181706.1|CX181706 A03_45-38_01.ab1 leaf inoculated wit... 34 9.6
gb|CX181868.1|CX181868 D12_45-122_08.ab1 leaf inoculated wi... 34 9.6
gb|CX184319.1|CX184319 D05_45-57_07.ab1 leaf inoculated wit... 34 9.6
gb|CX186087.1|CX186087 A03_45-113_01.ab1 leaf inoculated wi... 34 9.6
gb|CX186978.1|CX186978 D01_45-48_07.ab1 leaf inoculated wit... 34 9.6
gb|CX187344.1|CX187344 G04_45-105_14.ab1 leaf inoculated wi... 34 9.6
gb|CX654549.1|CX654549 PO02013G07 Poplar SC cDNA library Po... 34 9.6
gb|DT479657.1|DT479657 WS02526.BR_I24 PT-MB-N-A-15 Populus ... 34 9.6
gb|DT485620.1|DT485620 WS02528.B21_L12 PT-MB-N-A-15 Populus... 34 9.6
gb|DT488208.1|DT488208 WS02535.B21_M20 PT-MB-N-A-15 Populus... 34 9.6
gb|DT495578.1|DT495578 WS01120.BR_O07 PT-P-FL-A-2 Populus t... 34 9.6
gb|DT501703.1|DT501703 WS01313.BR_N13 PTxD-IL-FL-A-4 Populu... 34 9.6
gb|DT504560.1|DT504560 WS01313.B21_N13 PTxD-IL-FL-A-4 Popul... 34 9.6
gb|DT510932.1|DT510932 WS02429.BR_B15 PTxD-ICC-N-A-14 Popul... 34 9.6
gb|DT517909.1|DT517909 WS02435.B21_K13 PTxD-ICC-N-A-14 Popu... 34 9.6
gb|DT519854.1|DT519854 WS02443.B21_N21 PTxD-ICC-N-A-14 Popu... 34 9.6
gb|DV463385.1|DV463385 MTUNUL1.P15.C05 NUL Populus fremonti... 34 9.6
gb|DV466743.1|DV466743 MTUNUL1.P9.F06 NUL Populus fremontii... 34 9.6
>gb|BI125680.1|BI125680 I064P51P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 338
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 277 tcggaaacagcatgcttgg 259
>gb|BU815977.1|BU815977 N058E08 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 563
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 458 tcggaaacagcatgcttgg 440
>gb|BU889171.1|BU889171 P017E11 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 523
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 470 tcggaaacagcatgcttgg 452
>gb|BU894835.1|BU894835 X015G06 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 689
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 482 tcggaaacagcatgcttgg 464
>gb|CF230756.1|CF230756 PtaC0012F4F0412 Poplar cDNA library from cambial zone Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 595
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 354 tcggaaacagcatgcttgg 336
>gb|CF234473.1|CF234473 Ptajxojxo3A5A0501 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 772
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 477 tcggaaacagcatgcttgg 459
>gb|CF234696.1|CF234696 PtaJXT0014A8A0802 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 652
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 477 tcggaaacagcatgcttgg 459
>gb|CV229489.1|CV229489 WS01913.B21_H14 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01913_H14 3', mRNA sequence
Length = 342
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 291 tcggaaacagcatgcttgg 309
>gb|CV235704.1|CV235704 WS01221.B21_E03 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01221_E03 3', mRNA sequence
Length = 229
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 153 tcggaaacagcatgcttgg 171
>gb|CV271893.1|CV271893 WS0155.B21_P15 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0155_P15 3', mRNA sequence
Length = 703
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 259 tcggaaacagcatgcttgg 277
>gb|BP926141.1|BP926141 BP926141 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-055_L11.f 5', mRNA sequence
Length = 487
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 480 tcggaaacagcatgcttgg 462
>gb|DT479855.1|DT479855 WS02527.BR_C20 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02527_C20 5', mRNA sequence
Length = 529
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 262 tcggaaacagcatgcttgg 244
>gb|DT485058.1|DT485058 WS02527.B21_C20 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02527_C20 3', mRNA sequence
Length = 528
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 267 tcggaaacagcatgcttgg 285
>gb|DT488344.1|DT488344 WS02536.B21_C20 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02536_C20 3', mRNA sequence
Length = 528
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 267 tcggaaacagcatgcttgg 285
>gb|DT499078.1|DT499078 WS0117.BR_D18 PT-P-FL-A-2 Populus trichocarpa cDNA clone WS0117_D18
5', mRNA sequence
Length = 516
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 476 tcggaaacagcatgcttgg 458
>gb|DT518803.1|DT518803 WS02439.B21_F04 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02439_F04 3', mRNA sequence
Length = 560
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 311 tcggaaacagcatgcttgg 329
>emb|AJ698930.1| Populus euramericana partial mRNA for putative histone H2B (hish2B
gene)
Length = 363
Score = 38.2 bits (19), Expect = 0.62
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgcttgg 95
|||||||||||||||||||
Sbjct: 147 tcggaaacagcatgcttgg 129
>gb|DV465634.1|DV465634 MTUNUL1.P41.B04 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 882
Score = 36.2 bits (18), Expect = 2.4
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 940 cttggtaagaagaggaaacttg 961
||||| ||||||||||||||||
Sbjct: 828 cttggaaagaagaggaaacttg 807
>gb|BI122268.1|BI122268 I004P48P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 574
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgctt 93
|||||||||||||||||
Sbjct: 448 tcggaaacagcatgctt 432
>gb|BU809266.1|BU809266 UL55PG06 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 441
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 340 tagtggaaataacatca 356
>gb|BU828161.1|BU828161 K017P61P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 534
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgctt 93
|||||||||||||||||
Sbjct: 448 tcggaaacagcatgctt 432
>gb|BU835036.1|BU835036 T068G05 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 641
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgctt 93
|||||||||||||||||
Sbjct: 458 tcggaaacagcatgctt 442
>gb|BU870907.1|BU870907 Q019G06 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 659
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgctt 93
|||||||||||||||||
Sbjct: 453 tcggaaacagcatgctt 437
>gb|BU884995.1|BU884995 R019B06 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 609
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgctt 93
|||||||||||||||||
Sbjct: 435 tcggaaacagcatgctt 419
>gb|BU891656.1|BU891656 P053D11 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 677
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 655 aatgaatgcatcagcagaaat 635
>gb|BU895372.1|BU895372 X023B09 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 578
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgctt 93
|||||||||||||||||
Sbjct: 458 tcggaaacagcatgctt 442
>gb|CF233685.1|CF233685 PtaJXO0026E10E1010 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 633
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 77 tcggaaacagcatgctt 93
|||||||||||||||||
Sbjct: 469 tcggaaacagcatgctt 453
>gb|CK093919.1|CK093919 I004P48.3pR Populus senescing leaves cDNA library Populus tremula
cDNA clone I004P48 3', mRNA sequence
Length = 406
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 77 tcggaaacagcatgctt 93
|||||||||||||||||
Sbjct: 89 tcggaaacagcatgctt 105
>gb|CK097701.1|CK097701 UB59CPA09.3pR Populus active cambium cDNA library Populus tremula
cDNA clone UB59CPA09 3', mRNA sequence
Length = 952
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 232 aagttcacagctctggg 248
|||||||||||||||||
Sbjct: 462 aagttcacagctctggg 478
>gb|CK101751.1|CK101751 F115P74.5pR Populus flower cDNA library Populus trichocarpa cDNA
clone F115P74 5', mRNA sequence
Length = 516
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 591 agaggcgaaactgtccg 607
|||||||||||||||||
Sbjct: 497 agaggcgaaactgtccg 481
>gb|CK102281.1|CK102281 G071P82.5pR Populus tension wood cDNA library Populus tremula x
Populus tremuloides cDNA clone G071P82 5', mRNA sequence
Length = 443
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 946 aagaagaggaaacttgcaaag 966
|||||||||||| ||||||||
Sbjct: 195 aagaagaggaaagttgcaaag 175
>gb|CK107009.1|CK107009 UB43DPB11.5pR Populus active cambium cDNA library Populus tremula
cDNA clone UB43DPB11 5', mRNA sequence
Length = 504
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 303 tagtggaaataacatca 319
>gb|CK116907.1|CK116907 B019P62 Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone B019P62 5', mRNA sequence
Length = 386
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 137 tggctagtgctagttct 153
|||||||||||||||||
Sbjct: 122 tggctagtgctagttct 138
>gb|CN519205.1|CN519205 GQ0104.B3_M20 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0104_M20 5', mRNA sequence
Length = 800
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 262 gccatgcttttgaatgg 278
|||||||||||||||||
Sbjct: 125 gccatgcttttgaatgg 109
>gb|AJ776654.1|AJ776654 AJ776654 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400016F01F1, mRNA sequence
Length = 447
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 309 tagtggaaataacatca 325
>gb|CV225831.1|CV225831 WS0162.B21_I09 PT-DX-A-7 Populus trichocarpa cDNA clone WS0162_I09
3', mRNA sequence
Length = 658
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 578 gcagcagctgtgaagag 594
|||||||||||||||||
Sbjct: 618 gcagcagctgtgaagag 634
>gb|CV226365.1|CV226365 WS0164.B21_A23 PT-DX-A-7 Populus trichocarpa cDNA clone WS0164_A23
3', mRNA sequence
Length = 546
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 155 aatgaatgcatcagcagaaat 175
>gb|CV227020.1|CV227020 WS0165.B21_P11 PT-DX-A-7 Populus trichocarpa cDNA clone WS0165_P11
3', mRNA sequence
Length = 856
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 578 gcagcagctgtgaagag 594
|||||||||||||||||
Sbjct: 625 gcagcagctgtgaagag 641
>gb|CV227933.1|CV227933 WS0168.B21_K03 PT-DX-A-7 Populus trichocarpa cDNA clone WS0168_K03
3', mRNA sequence
Length = 658
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 578 gcagcagctgtgaagag 594
|||||||||||||||||
Sbjct: 618 gcagcagctgtgaagag 634
>gb|CV229132.1|CV229132 WS01912.B21_F02 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01912_F02 3', mRNA sequence
Length = 695
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 110 aatgaatgcatcagcagaaat 130
>gb|CV229353.1|CV229353 WS01913.B21_A16 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01913_A16 3', mRNA sequence
Length = 639
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 578 gcagcagctgtgaagag 594
|||||||||||||||||
Sbjct: 561 gcagcagctgtgaagag 577
>gb|CV240266.1|CV240266 WS0234.B21_O16 PT-MB-A-13 Populus trichocarpa cDNA clone WS0234_O16
3', mRNA sequence
Length = 710
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 143 aatgaatgcatcagcagaaat 163
>gb|CV240657.1|CV240657 WS0251.B21_P19 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS0251_P19 3', mRNA sequence
Length = 892
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 140 aatgaatgcatcagcagaaat 160
>gb|CV243650.1|CV243650 WS0252.B21_H18 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS0252_H18 3', mRNA sequence
Length = 866
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 114 aatgaatgcatcagcagaaat 134
>gb|CV248474.1|CV248474 WS01120.B21_O07 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01120_O07 3', mRNA sequence
Length = 540
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 138 aatgaatgcatcagcagaaat 158
>gb|CV254420.1|CV254420 WS0241.B21_C23 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0241_C23 3', mRNA sequence
Length = 875
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 157 aatgaatgcatcagcagaaat 177
>gb|CV255916.1|CV255916 WS0242.B21_G14 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0242_G14 3', mRNA sequence
Length = 830
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 143 aatgaatgcatcagcagaaat 163
>gb|CV258964.1|CV258964 WS0201.B21_P21 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS0201_P21 3', mRNA sequence
Length = 728
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 140 aatgaatgcatcagcagaaat 160
>gb|CV260639.1|CV260639 WS02014.B21_J20 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02014_J20 3', mRNA sequence
Length = 835
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 578 gcagcagctgtgaagag 594
|||||||||||||||||
Sbjct: 715 gcagcagctgtgaagag 731
>gb|CV268614.1|CV268614 WS0205.B21_P15 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS0205_P15 3', mRNA sequence
Length = 455
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 114 aatgaatgcatcagcagaaat 134
>gb|CV734581.1|CV734581 F00D02 two-month-old leaves from clone 'Beaupre' Populus
trichocarpa x Populus deltoides cDNA 5', mRNA sequence
Length = 494
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 937 tggcttggtaagaagag 953
|||||||||||||||||
Sbjct: 392 tggcttggtaagaagag 408
>gb|CX169561.1|CX169561 G10_69-109_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 658
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 317 tagtggaaataacatca 333
>gb|CX170183.1|CX170183 G11_69-99_13.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 622
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 318 tagtggaaataacatca 334
>gb|CX170883.1|CX170883 B07_69-93_03.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 622
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 386 tagtggaaataacatca 402
>gb|CX171680.1|CX171680 C01_69-18_05.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 471
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 306 tagtggaaataacatca 322
>gb|CX172617.1|CX172617 G01_69-75_13.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 648
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 105 tagtggaaataacatca 121
>gb|CX174443.1|CX174443 E01_69-53_09.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 702
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 298 tagtggaaataacatca 314
>gb|CX176035.1|CX176035 F09_69-67_11.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 702
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 332 tagtggaaataacatca 348
>gb|CX177762.1|CX177762 G08_45-72_14.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 622
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 283 tagtggaaataacatca 299
>gb|CX178363.1|CX178363 E02_45-15_10.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 647
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 205 gtcttcacattctcaga 221
|||||||||||||||||
Sbjct: 430 gtcttcacattctcaga 446
>gb|CX178397.1|CX178397 D08_45-108_08.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 530
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 284 tagtggaaataacatca 300
>gb|CX181005.1|CX181005 G12_45-69_14.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 667
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 205 gtcttcacattctcaga 221
|||||||||||||||||
Sbjct: 433 gtcttcacattctcaga 449
>gb|CX181706.1|CX181706 A03_45-38_01.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 641
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 310 tagtggaaataacatca 326
>gb|CX181868.1|CX181868 D12_45-122_08.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 693
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 318 tagtggaaataacatca 334
>gb|CX184319.1|CX184319 D05_45-57_07.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 713
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 346 tagtggaaataacatca 362
>gb|CX186087.1|CX186087 A03_45-113_01.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 646
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 351 tagtggaaataacatca 367
>gb|CX186978.1|CX186978 D01_45-48_07.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 683
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 330 tagtggaaataacatca 346
>gb|CX187344.1|CX187344 G04_45-105_14.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 596
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 519 tagtggaaataacatca 535
>gb|CX654549.1|CX654549 PO02013G07 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO02013G07 5', mRNA sequence
Length = 591
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 942 tggtaagaagaggaaac 958
|||||||||||||||||
Sbjct: 444 tggtaagaagaggaaac 428
>gb|DT479657.1|DT479657 WS02526.BR_I24 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02526_I24 5', mRNA sequence
Length = 856
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 313 tagtggaaataacatca 329
>gb|DT485620.1|DT485620 WS02528.B21_L12 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02528_L12 3', mRNA sequence
Length = 893
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 140 aatgaatgcatcagcagaaat 160
>gb|DT488208.1|DT488208 WS02535.B21_M20 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02535_M20 3', mRNA sequence
Length = 876
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 114 aatgaatgcatcagcagaaat 134
>gb|DT495578.1|DT495578 WS01120.BR_O07 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01120_O07 5', mRNA sequence
Length = 919
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 782 aatgaatgcatcagcagaaat 762
>gb|DT501703.1|DT501703 WS01313.BR_N13 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS01313_N13 5', mRNA sequence
Length = 877
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 205 gtcttcacattctcaga 221
|||||||||||||||||
Sbjct: 384 gtcttcacattctcaga 400
>gb|DT504560.1|DT504560 WS01313.B21_N13 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS01313_N13 3', mRNA sequence
Length = 908
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 205 gtcttcacattctcaga 221
|||||||||||||||||
Sbjct: 705 gtcttcacattctcaga 689
>gb|DT510932.1|DT510932 WS02429.BR_B15 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02429_B15 5', mRNA sequence
Length = 818
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 633 ctactgctacaactcatcaaa 653
||||||| |||||||||||||
Sbjct: 42 ctactgcaacaactcatcaaa 22
>gb|DT517909.1|DT517909 WS02435.B21_K13 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02435_K13 3', mRNA sequence
Length = 556
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 156 aatgaatgcatcagcagaaat 176
>gb|DT519854.1|DT519854 WS02443.B21_N21 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02443_N21 3', mRNA sequence
Length = 857
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 736 aatgaatgcatcaccagaaat 756
||||||||||||| |||||||
Sbjct: 116 aatgaatgcatcagcagaaat 136
>gb|DV463385.1|DV463385 MTUNUL1.P15.C05 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 944
Score = 34.2 bits (17), Expect = 9.6
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 323 gaaataacatcatcgacggct 343
|||||||||||||| ||||||
Sbjct: 205 gaaataacatcatcaacggct 185
>gb|DV466743.1|DV466743 MTUNUL1.P9.F06 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 908
Score = 34.2 bits (17), Expect = 9.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 318 tagtggaaataacatca 334
|||||||||||||||||
Sbjct: 315 tagtggaaataacatca 331
Database: Populus_nucl_with_EST.fasta
Posted date: May 2, 2006 3:31 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 112,464
Number of Sequences: 369679
Number of extensions: 112464
Number of successful extensions: 30879
Number of sequences better than 10.0: 81
Number of HSP's better than 10.0 without gapping: 81
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30797
Number of HSP's gapped (non-prelim): 82
length of query: 980
length of database: 203,408,664
effective HSP length: 19
effective length of query: 961
effective length of database: 196,384,763
effective search space: 188725757243
effective search space used: 188725757243
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)