BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3802544.2.1
         (814 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BU876164.1|BU876164  V017A02 Populus flower cDNA library ...    58   5e-007
gb|BI128256.1|BI128256  G073P27Y Populus cambium cDNA librar...    50   1e-004
gb|CK087758.1|CK087758  A020P14.3pR Hybrid aspen plasmid lib...    50   1e-004
gb|BI131440.1|BI131440  G120P89Y Populus cambium cDNA librar...    42   0.033
gb|CX658013.1|CX658013  PO01008B12 Poplar SC cDNA library Po...    42   0.033

>gb|BU876164.1|BU876164 V017A02 Populus flower cDNA library Populus trichocarpa cDNA 5
           prime, mRNA sequence
          Length = 540

 Score = 58.0 bits (29), Expect = 5e-007
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
           |||||||||||||| |||| ||| |  |||||||||||||| |||||||||||
Sbjct: 332 atgttttctggtggccttaggtacaacgtcttgttcaatgctcgaggatcatc 280



>gb|BI128256.1|BI128256 G073P27Y Populus cambium cDNA library Populus tremula x Populus
           tremuloides cDNA, mRNA sequence
          Length = 517

 Score = 50.1 bits (25), Expect = 1e-004
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
           |||||||||||||| |||| ||| |  |||||||||||||  |||||||||||
Sbjct: 123 atgttttctggtggccttaggtacaaggtcttgttcaatgtccgaggatcatc 71




 Score = 42.1 bits (21), Expect = 0.033
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 193 ctccatcgtcgccgatttcaaaatttgtcaagcaaccttcatagaaaat 241
           ||||||| || || ||||| || |||||||| || ||||||||||||||
Sbjct: 317 ctccatcttctcctatttcgaagtttgtcaaacagccttcatagaaaat 269



>gb|CK087758.1|CK087758 A020P14.3pR Hybrid aspen plasmid library Populus tremula x Populus
           tremuloides cDNA clone A020P14 3', mRNA sequence
          Length = 794

 Score = 50.1 bits (25), Expect = 1e-004
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
           |||||||||||||| |||| ||| |  |||||||||||||  |||||||||||
Sbjct: 400 atgttttctggtggccttaggtacaaggtcttgttcaatgtccgaggatcatc 452




 Score = 42.1 bits (21), Expect = 0.033
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 193 ctccatcgtcgccgatttcaaaatttgtcaagcaaccttcatagaaaat 241
           ||||||| || || ||||| || |||||||| || ||||||||||||||
Sbjct: 206 ctccatcttctcctatttcgaagtttgtcaaacagccttcatagaaaat 254



>gb|BI131440.1|BI131440 G120P89Y Populus cambium cDNA library Populus tremula x Populus
           tremuloides cDNA, mRNA sequence
          Length = 424

 Score = 42.1 bits (21), Expect = 0.033
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
           ||||| |||||||| |||| ||| |  |||||||||||||  |||||||||||
Sbjct: 251 atgttctctggtggccttaggtacaaggtcttgttcaatgtccgaggatcatc 303




 Score = 42.1 bits (21), Expect = 0.033
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 193 ctccatcgtcgccgatttcaaaatttgtcaagcaaccttcatagaaaat 241
           ||||||| || || ||||| || |||||||| || ||||||||||||||
Sbjct: 57  ctccatcttctcctatttcgaagtttgtcaaacagccttcatagaaaat 105



>gb|CX658013.1|CX658013 PO01008B12 Poplar SC cDNA library Populus alba x Populus tremula
           var. glandulosa cDNA clone PO01008B12 5', mRNA sequence
          Length = 483

 Score = 42.1 bits (21), Expect = 0.033
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 387 atgttttctggtggtcttatgtatagtgtcttgttcaatgcgcgaggatcatc 439
           |||||||||||||| |||| ||| |  || ||||||||||  |||||||||||
Sbjct: 114 atgttttctggtggccttaggtacaaggttttgttcaatgtccgaggatcatc 62



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 91,269
Number of Sequences: 369679
Number of extensions: 91269
Number of successful extensions: 24420
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24406
Number of HSP's gapped (non-prelim): 14
length of query: 814
length of database: 203,408,664
effective HSP length: 19
effective length of query: 795
effective length of database: 196,384,763
effective search space: 156125886585
effective search space used: 156125886585
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)