BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3128444.2.1
(857 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU816643.1|BU816643 N069F11 Populus bark cDNA library Po... 44 0.009
gb|BU823778.1|BU823778 UB56BPD10 Populus tremula cambium cD... 44 0.009
gb|BU830429.1|BU830429 T008B12 Populus apical shoot cDNA li... 44 0.009
gb|CK090495.1|CK090495 F008P84.3pR Populus flower cDNA libr... 44 0.009
gb|CK097608.1|CK097608 UB56BPD10.3pR Populus active cambium... 44 0.009
gb|CK107403.1|CK107403 UB56BPD10.5pR Populus active cambium... 44 0.009
gb|CV130609.1|CV130609 B9SP06h03 Populus stem seasonal libr... 44 0.009
gb|CV263577.1|CV263577 WS02022.B21_D16 PTxN-IB-N-A-11 Popul... 44 0.009
gb|CV271153.1|CV271153 WS0153.B21_O23 PTxN-IB-A-6 Populus t... 44 0.009
gb|CV276879.1|CV276879 WS0142.B21_A18 PTxD-IL-A-5 Populus t... 44 0.009
gb|CV276936.1|CV276936 WS0142.B21_D09 PTxD-IL-A-5 Populus t... 44 0.009
gb|DN484727.1|DN484727 K011P14.3pR Populus apical shoot cDN... 44 0.009
gb|DN494199.1|DN494199 K011P14.5pR Populus apical shoot cDN... 44 0.009
gb|DT514016.1|DT514016 WS02423.B21_K04 PTxD-ICC-N-A-14 Popu... 44 0.009
gb|BU880689.1|BU880689 UM53TC06 Populus flower cDNA library... 42 0.034
gb|CF119227.1|CF119227 MTU10CS.P15.B06 Aspen stem cDNA Libr... 42 0.034
>gb|BU816643.1|BU816643 N069F11 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 668
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 240 tggtcattactggacaactttgagtgggct 269
>gb|BU823778.1|BU823778 UB56BPD10 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 421
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 138 tggtcattactggacaactttgagtgggct 167
>gb|BU830429.1|BU830429 T008B12 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 385
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 3 tggtcattactggacaactttgagtgggct 32
>gb|CK090495.1|CK090495 F008P84.3pR Populus flower cDNA library Populus trichocarpa cDNA
clone F008P84 3', mRNA sequence
Length = 793
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 402 tggtcattactggacaactttgagtgggct 373
Score = 42.1 bits (21), Expect = 0.034
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 365 agaaatacaacagtccagtaatttatgttactgagaatggcatggatga 413
|||||||||||| ||| ||| |||||||| |||||||| ||||||||
Sbjct: 578 agaaatacaacaatcccacaatatatgttacagagaatggtatggatga 530
>gb|CK097608.1|CK097608 UB56BPD10.3pR Populus active cambium cDNA library Populus tremula
cDNA clone UB56BPD10 3', mRNA sequence
Length = 459
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 320 tggtcattactggacaactttgagtgggct 291
>gb|CK107403.1|CK107403 UB56BPD10.5pR Populus active cambium cDNA library Populus tremula
cDNA clone UB56BPD10 5', mRNA sequence
Length = 473
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 151 tggtcattactggacaactttgagtgggct 180
>gb|CV130609.1|CV130609 B9SP06h03 Populus stem seasonal library Populus deltoides cDNA,
mRNA sequence
Length = 742
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 374 tggtcattactggacaactttgagtgggct 403
>gb|CV263577.1|CV263577 WS02022.B21_D16 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02022_D16 3', mRNA sequence
Length = 448
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 421 tggtcattactggacaactttgagtgggct 392
>gb|CV271153.1|CV271153 WS0153.B21_O23 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0153_O23 3', mRNA sequence
Length = 914
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 422 tggtcattactggacaactttgagtgggct 393
>gb|CV276879.1|CV276879 WS0142.B21_A18 PTxD-IL-A-5 Populus trichocarpa x Populus deltoides
cDNA clone WS0142_A18 3', mRNA sequence
Length = 916
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 477 tggtcattactggacaactttgagtgggct 448
Score = 42.1 bits (21), Expect = 0.034
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 365 agaaatacaacagtccagtaatttatgttactgagaatggcatggatga 413
|||||||||||| ||| ||| |||||||| |||||||| ||||||||
Sbjct: 653 agaaatacaacaatcccacaatatatgttacagagaatggtatggatga 605
>gb|CV276936.1|CV276936 WS0142.B21_D09 PTxD-IL-A-5 Populus trichocarpa x Populus deltoides
cDNA clone WS0142_D09 3', mRNA sequence
Length = 885
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 454 tggtcattactggacaactttgagtgggct 425
Score = 42.1 bits (21), Expect = 0.034
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 365 agaaatacaacagtccagtaatttatgttactgagaatggcatggatga 413
|||||||||||| ||| ||| |||||||| |||||||| ||||||||
Sbjct: 630 agaaatacaacaatcccacaatatatgttacagagaatggtatggatga 582
>gb|DN484727.1|DN484727 K011P14.3pR Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA clone K011P14 3', mRNA sequence
Length = 332
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 315 tggtcattactggacaactttgagtgggct 286
>gb|DN494199.1|DN494199 K011P14.5pR Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA clone K011P14 5', mRNA sequence
Length = 82
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 17 tggtcattactggacaactttgagtgggct 46
>gb|DT514016.1|DT514016 WS02423.B21_K04 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02423_K04 3', mRNA sequence
Length = 910
Score = 44.1 bits (22), Expect = 0.009
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 544 tggtcattcctggacaacttcgagtgggct 573
|||||||| ||||||||||| |||||||||
Sbjct: 308 tggtcattactggacaactttgagtgggct 279
Score = 42.1 bits (21), Expect = 0.034
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 365 agaaatacaacagtccagtaatttatgttactgagaatggcatggatga 413
|||||||||||| ||| ||| |||||||| |||||||| ||||||||
Sbjct: 484 agaaatacaacaatcccacaatatatgttacagagaatggtatggatga 436
>gb|BU880689.1|BU880689 UM53TC06 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 570
Score = 42.1 bits (21), Expect = 0.034
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 365 agaaatacaacagtccagtaatttatgttactgagaatggcatggatga 413
|||||||||||| ||| ||| |||||||| |||||||| ||||||||
Sbjct: 474 agaaatacaacaatcccacaatatatgttacagagaatggtatggatga 522
>gb|CF119227.1|CF119227 MTU10CS.P15.B06 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 462
Score = 42.1 bits (21), Expect = 0.034
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 365 agaaatacaacagtccagtaatttatgttactgagaatggcatggatga 413
|||||||||||| ||| ||| |||||||| |||||||| ||||||||
Sbjct: 152 agaaatacaacaatcccacaatatatgttacagagaatggtatggatga 104
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 94,899
Number of Sequences: 369679
Number of extensions: 94899
Number of successful extensions: 24622
Number of sequences better than 0.5: 16
Number of HSP's better than 0.5 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24596
Number of HSP's gapped (non-prelim): 26
length of query: 857
length of database: 203,408,664
effective HSP length: 19
effective length of query: 838
effective length of database: 196,384,763
effective search space: 164570431394
effective search space used: 164570431394
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)