BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3067043.2.1
         (834 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BU809624.1|BU809624  UL60PA08 Populus leaf cDNA library P...    42   0.033
gb|BU809625.1|BU809625  UL60PA09 Populus leaf cDNA library P...    42   0.033
gb|BU809626.1|BU809626  UL60PA10 Populus leaf cDNA library P...    42   0.033
gb|DN490529.1|DN490529  UL60PA09.3pR Populus cold stressed l...    42   0.033
gb|DN500515.1|DN500515  UL60PA09.5pR Populus cold stressed l...    42   0.033

>gb|BU809624.1|BU809624 UL60PA08 Populus leaf cDNA library Populus tremula x Populus
           tremuloides cDNA 5 prime, mRNA sequence
          Length = 335

 Score = 42.1 bits (21), Expect = 0.033
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 123 ccttttgcttcattggtcacc 143
           |||||||||||||||||||||
Sbjct: 143 ccttttgcttcattggtcacc 163



>gb|BU809625.1|BU809625 UL60PA09 Populus leaf cDNA library Populus tremula x Populus
           tremuloides cDNA 5 prime, mRNA sequence
          Length = 390

 Score = 42.1 bits (21), Expect = 0.033
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 123 ccttttgcttcattggtcacc 143
           |||||||||||||||||||||
Sbjct: 143 ccttttgcttcattggtcacc 163



>gb|BU809626.1|BU809626 UL60PA10 Populus leaf cDNA library Populus tremula x Populus
           tremuloides cDNA 5 prime, mRNA sequence
          Length = 330

 Score = 42.1 bits (21), Expect = 0.033
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 123 ccttttgcttcattggtcacc 143
           |||||||||||||||||||||
Sbjct: 142 ccttttgcttcattggtcacc 162



>gb|DN490529.1|DN490529 UL60PA09.3pR Populus cold stressed leaves cDNA library Populus
           tremula x Populus tremuloides cDNA clone UL60PA09 3',
           mRNA sequence
          Length = 564

 Score = 42.1 bits (21), Expect = 0.033
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 123 ccttttgcttcattggtcacc 143
           |||||||||||||||||||||
Sbjct: 421 ccttttgcttcattggtcacc 401



>gb|DN500515.1|DN500515 UL60PA09.5pR Populus cold stressed leaves cDNA library Populus
           tremula x Populus tremuloides cDNA clone UL60PA09 5',
           mRNA sequence
          Length = 570

 Score = 42.1 bits (21), Expect = 0.033
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 123 ccttttgcttcattggtcacc 143
           |||||||||||||||||||||
Sbjct: 144 ccttttgcttcattggtcacc 164



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 110,556
Number of Sequences: 369679
Number of extensions: 110556
Number of successful extensions: 32339
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32334
Number of HSP's gapped (non-prelim): 5
length of query: 834
length of database: 203,408,664
effective HSP length: 19
effective length of query: 815
effective length of database: 196,384,763
effective search space: 160053581845
effective search space used: 160053581845
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)