BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2943856.2.2
(661 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AI163550.1|AI163550 A044P28U Hybrid aspen plasmid librar... 42 0.026
gb|BU835172.1|BU835172 T070E05 Populus apical shoot cDNA li... 40 0.10
gb|BU889124.1|BU889124 P017A05 Populus petioles cDNA librar... 40 0.10
gb|DN486318.1|DN486318 P017A05.3pR Populus petioles cDNA li... 40 0.10
gb|BI130835.1|BI130835 G111P44Y Populus cambium cDNA librar... 38 0.41
gb|BU837702.1|BU837702 T104G07 Populus apical shoot cDNA li... 38 0.41
gb|CF235749.1|CF235749 PtaJXT0026E7E0709 Poplar cDNA librar... 38 0.41
gb|AJ776685.1|AJ776685 AJ776685 Populus euphratica root 3-6... 38 0.41
gb|CV254870.1|CV254870 WS02411.B21_G21 PTxD-ICC-N-A-14 Popu... 38 0.41
gb|DT511624.1|DT511624 WS02416.B21_P14 PTxD-ICC-N-A-14 Popu... 38 0.41
>gb|AI163550.1|AI163550 A044P28U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 298
Score = 42.1 bits (21), Expect = 0.026
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 364 ctttctttattttcgttcttcttcttctt 392
||||||||||||| ||||||||||||||
Sbjct: 136 ctttctttatttttcttcttcttcttctt 108
>gb|BU835172.1|BU835172 T070E05 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 475
Score = 40.1 bits (20), Expect = 0.10
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 366 ttctttattttcgttcttcttcttcttc 393
|||||||||| | |||||||||||||||
Sbjct: 63 ttctttatttcctttcttcttcttcttc 90
>gb|BU889124.1|BU889124 P017A05 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 541
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 272 tttcgttcttcttcttcttc 253
>gb|DN486318.1|DN486318 P017A05.3pR Populus petioles cDNA library Populus tremula cDNA
clone P017A05 3', mRNA sequence
Length = 495
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 224 tttcgttcttcttcttcttc 243
>gb|BI130835.1|BI130835 G111P44Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 471
Score = 38.2 bits (19), Expect = 0.41
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 379 ttcttcttcttcttcgtca 397
|||||||||||||||||||
Sbjct: 101 ttcttcttcttcttcgtca 83
>gb|BU837702.1|BU837702 T104G07 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 689
Score = 38.2 bits (19), Expect = 0.41
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 379 ttcttcttcttcttcgtca 397
|||||||||||||||||||
Sbjct: 620 ttcttcttcttcttcgtca 602
>gb|CF235749.1|CF235749 PtaJXT0026E7E0709 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 730
Score = 38.2 bits (19), Expect = 0.41
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgtc 396
|||||||||||||||||||
Sbjct: 12 gttcttcttcttcttcgtc 30
>gb|AJ776685.1|AJ776685 AJ776685 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400017A12F1, mRNA sequence
Length = 460
Score = 38.2 bits (19), Expect = 0.41
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 374 tttcgttcttcttcttcttcgtc 396
||||| |||||||||||||||||
Sbjct: 95 tttcgatcttcttcttcttcgtc 73
>gb|CV254870.1|CV254870 WS02411.B21_G21 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02411_G21 3', mRNA sequence
Length = 886
Score = 38.2 bits (19), Expect = 0.41
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtca 397
|||||||||||||||||||
Sbjct: 628 ttcttcttcttcttcgtca 646
>gb|DT511624.1|DT511624 WS02416.B21_P14 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02416_P14 3', mRNA sequence
Length = 689
Score = 38.2 bits (19), Expect = 0.41
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 374 tttcgttcttcttcttcttcgtc 396
|||| ||||||||||||||||||
Sbjct: 370 tttccttcttcttcttcttcgtc 392
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 102,531
Number of Sequences: 369679
Number of extensions: 102531
Number of successful extensions: 39753
Number of sequences better than 0.5: 11
Number of HSP's better than 0.5 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39710
Number of HSP's gapped (non-prelim): 31
length of query: 661
length of database: 203,408,664
effective HSP length: 19
effective length of query: 642
effective length of database: 196,384,763
effective search space: 126079017846
effective search space used: 126079017846
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)