BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750560.2.1
(660 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CX187326.1|CX187326 B07_45-53_03.ab1 leaf inoculated wit... 52 3e-005
gb|CV244991.1|CV244991 WS0256.B21_D04 PT-MB-N-A-15 Populus ... 50 1e-004
gb|CV256321.1|CV256321 WS0243.B21_I14 PTxD-ICC-N-A-14 Popul... 50 1e-004
gb|BI138460.1|BI138460 F106P90Y Populus flower cDNA library... 44 0.007
gb|CX169926.1|CX169926 H11_69-23_15.ab1 leaf inoculated wit... 44 0.007
gb|CX172797.1|CX172797 E03_69-28_09.ab1 leaf inoculated wit... 44 0.007
gb|CX176885.1|CX176885 G06_69-59_14.ab1 leaf inoculated wit... 44 0.007
gb|CX177176.1|CX177176 H10_69-45_16.ab1 leaf inoculated wit... 44 0.007
gb|CX177743.1|CX177743 E05_45-95_09.ab1 leaf inoculated wit... 44 0.007
gb|CX177748.1|CX177748 D05_45-107_07.ab1 leaf inoculated wi... 44 0.007
gb|CX179436.1|CX179436 B02_45-52_04.ab1 leaf inoculated wit... 44 0.007
gb|CX180955.1|CX180955 G12_45-73_14.ab1 leaf inoculated wit... 44 0.007
gb|CX181832.1|CX181832 C02_45-95_06.ab1 leaf inoculated wit... 44 0.007
gb|CX182029.1|CX182029 A12_45-94_02.ab1 leaf inoculated wit... 44 0.007
gb|BU821803.1|BU821803 UB28CPB01 Populus tremula cambium cD... 42 0.026
gb|CK106655.1|CK106655 UB28CPB01.5pR Populus active cambium... 42 0.026
gb|CX167789.1|CX167789 G03_69-34_13.ab1 leaf inoculated wit... 42 0.026
gb|CX168069.1|CX168069 D03_69-120_07.ab1 leaf inoculated wi... 42 0.026
gb|CX168157.1|CX168157 D09_69-15_07.ab1 leaf inoculated wit... 42 0.026
gb|CX168270.1|CX168270 G12_69-60_14.ab1 leaf inoculated wit... 42 0.026
gb|CX168285.1|CX168285 F02_69-15_12.ab1 leaf inoculated wit... 42 0.026
gb|CX169627.1|CX169627 A12_69-34_02.ab1 leaf inoculated wit... 42 0.026
gb|CX169638.1|CX169638 E06_69-34_10.ab1 leaf inoculated wit... 42 0.026
gb|CX169916.1|CX169916 C10_69-58_06.ab1 leaf inoculated wit... 42 0.026
gb|CX169937.1|CX169937 C06_69-81_06.ab1 leaf inoculated wit... 42 0.026
gb|CX170948.1|CX170948 C09_69-34_05.ab1 leaf inoculated wit... 42 0.026
gb|CX171108.1|CX171108 C10_69-40_06.ab1 leaf inoculated wit... 42 0.026
gb|CX171302.1|CX171302 E07_69-45_09.ab1 leaf inoculated wit... 42 0.026
gb|CX171358.1|CX171358 C07_69-81_05.ab1 leaf inoculated wit... 42 0.026
gb|CX171655.1|CX171655 G11_69-34_13.ab1 leaf inoculated wit... 42 0.026
gb|CX171758.1|CX171758 G12_69-33_14.ab1 leaf inoculated wit... 42 0.026
gb|CX171865.1|CX171865 A01_69-37_01.ab1 leaf inoculated wit... 42 0.026
gb|CX171954.1|CX171954 B03_69-1_03.ab1 leaf inoculated with... 42 0.026
gb|CX172038.1|CX172038 A09_69-122_01.ab1 leaf inoculated wi... 42 0.026
gb|CX172206.1|CX172206 H03_69-93_15.ab1 leaf inoculated wit... 42 0.026
gb|CX172248.1|CX172248 D04_69-69_08.ab1 leaf inoculated wit... 42 0.026
gb|CX172522.1|CX172522 D06_69-81_08.ab1 leaf inoculated wit... 42 0.026
gb|CX172616.1|CX172616 G05_69-23_13.ab1 leaf inoculated wit... 42 0.026
gb|CX172975.1|CX172975 H11_69-60_15.ab1 leaf inoculated wit... 42 0.026
gb|CX173397.1|CX173397 F06_69-25_12.ab1 leaf inoculated wit... 42 0.026
gb|CX173813.1|CX173813 E03_69-122_09.ab1 leaf inoculated wi... 42 0.026
gb|CX173915.1|CX173915 B04_69-116_04.ab1 leaf inoculated wi... 42 0.026
gb|CX174135.1|CX174135 G08_69-34_14.ab1 leaf inoculated wit... 42 0.026
gb|CX174395.1|CX174395 F06_69-46_12.ab1 leaf inoculated wit... 42 0.026
gb|CX174398.1|CX174398 G09_69-43_13.ab1 leaf inoculated wit... 42 0.026
gb|CX174410.1|CX174410 G04_69-43_14.ab1 leaf inoculated wit... 42 0.026
gb|CX174539.1|CX174539 H07_69-23_15.ab1 leaf inoculated wit... 42 0.026
gb|CX174558.1|CX174558 F07_69-112_11.ab1 leaf inoculated wi... 42 0.026
gb|CX174863.1|CX174863 G06_69-34_14.ab1 leaf inoculated wit... 42 0.026
gb|CX175041.1|CX175041 G11_69-24_13.ab1 leaf inoculated wit... 42 0.026
gb|CX176029.1|CX176029 A02_69-81_02.ab1 leaf inoculated wit... 42 0.026
gb|CX176038.1|CX176038 D01_69-81_07.ab1 leaf inoculated wit... 42 0.026
gb|CX176264.1|CX176264 G08_69-46_14.ab1 leaf inoculated wit... 42 0.026
gb|CX176331.1|CX176331 A07_69-34_01.ab1 leaf inoculated wit... 42 0.026
gb|CX176379.1|CX176379 E05_69-43_09.ab1 leaf inoculated wit... 42 0.026
gb|CX176750.1|CX176750 F06_69-15_12.ab1 leaf inoculated wit... 42 0.026
gb|CX176805.1|CX176805 E04_69-57_10.ab1 leaf inoculated wit... 42 0.026
gb|CX176977.1|CX176977 H04_69-43_16.ab1 leaf inoculated wit... 42 0.026
gb|CX177325.1|CX177325 D01_69-55_07.ab1 leaf inoculated wit... 42 0.026
gb|CX177339.1|CX177339 E10_45-94_10.ab1 leaf inoculated wit... 42 0.026
gb|CX177428.1|CX177428 G12_45-96_14.ab1 leaf inoculated wit... 42 0.026
gb|CX177509.1|CX177509 A06_45-64_02.ab1 leaf inoculated wit... 42 0.026
gb|CX178343.1|CX178343 G10_45-66_14.ab1 leaf inoculated wit... 42 0.026
gb|CX178359.1|CX178359 C06_45-105_06.ab1 leaf inoculated wi... 42 0.026
gb|CX179386.1|CX179386 C11_45-94_05.ab1 leaf inoculated wit... 42 0.026
gb|CX179421.1|CX179421 C05_45-58_05.ab1 leaf inoculated wit... 42 0.026
gb|CX179545.1|CX179545 B03_45-120_03.ab1 leaf inoculated wi... 42 0.026
gb|CX179615.1|CX179615 F08_45-70_12.ab1 leaf inoculated wit... 42 0.026
gb|CX179664.1|CX179664 H05_45-117_15.ab1 leaf inoculated wi... 42 0.026
gb|CX179686.1|CX179686 H09_45-60_15.ab1 leaf inoculated wit... 42 0.026
gb|CX179809.1|CX179809 G02_45-98_14.ab1 leaf inoculated wit... 42 0.026
gb|CX179831.1|CX179831 B09_45-56_03.ab1 leaf inoculated wit... 42 0.026
gb|CX180027.1|CX180027 H11_45-97_15.ab1 leaf inoculated wit... 42 0.026
gb|CX180255.1|CX180255 G03_45-77_13.ab1 leaf inoculated wit... 42 0.026
gb|CX180734.1|CX180734 H03_45-65_15.ab1 leaf inoculated wit... 42 0.026
gb|CX180957.1|CX180957 F09_45-100_11.ab1 leaf inoculated wi... 42 0.026
gb|CX181051.1|CX181051 C08_45-56_06.ab1 leaf inoculated wit... 42 0.026
gb|CX181108.1|CX181108 D01_45-80_07.ab1 leaf inoculated wit... 42 0.026
gb|CX181149.1|CX181149 A12_45-105_02.ab1 leaf inoculated wi... 42 0.026
gb|CX181172.1|CX181172 E06_45-56_10.ab1 leaf inoculated wit... 42 0.026
gb|CX181467.1|CX181467 H02_45-77_16.ab1 leaf inoculated wit... 42 0.026
gb|CX181516.1|CX181516 H09_45-100_15.ab1 leaf inoculated wi... 42 0.026
gb|CX181534.1|CX181534 H02_45-64_16.ab1 leaf inoculated wit... 42 0.026
gb|CX181549.1|CX181549 F01_45-97_11.ab1 leaf inoculated wit... 42 0.026
gb|CX181664.1|CX181664 D04_45-70_08.ab1 leaf inoculated wit... 42 0.026
gb|CX181737.1|CX181737 G10_45-60_14.ab1 leaf inoculated wit... 42 0.026
gb|CX181745.1|CX181745 H06_45-106_16.ab1 leaf inoculated wi... 42 0.026
gb|CX181961.1|CX181961 F07_45-40_11.ab1 leaf inoculated wit... 42 0.026
gb|CX182041.1|CX182041 E06_45-94_10.ab1 leaf inoculated wit... 42 0.026
gb|CX182255.1|CX182255 D05_45-105_07.ab1 leaf inoculated wi... 42 0.026
gb|CX182370.1|CX182370 D12_45-59_08.ab1 leaf inoculated wit... 42 0.026
gb|CX182652.1|CX182652 F12_45-97_12.ab1 leaf inoculated wit... 42 0.026
gb|CX182673.1|CX182673 G10_45-121_14.ab1 leaf inoculated wi... 42 0.026
gb|CX183063.1|CX183063 B03_45-64_03.ab1 leaf inoculated wit... 42 0.026
gb|CX183089.1|CX183089 C07_45-73_05.ab1 leaf inoculated wit... 42 0.026
gb|CX183721.1|CX183721 D08_45-56_08.ab1 leaf inoculated wit... 42 0.026
gb|CX183839.1|CX183839 G04_45-53_14.ab1 leaf inoculated wit... 42 0.026
gb|CX183891.1|CX183891 E04_45-98_10.ab1 leaf inoculated wit... 42 0.026
gb|CX183894.1|CX183894 F07_45-95_11.ab1 leaf inoculated wit... 42 0.026
gb|CX183910.1|CX183910 F02_45-95_12.ab1 leaf inoculated wit... 42 0.026
gb|CX184187.1|CX184187 A11_45-94_01.ab1 leaf inoculated wit... 42 0.026
gb|CX184306.1|CX184306 A11_45-77_01.ab1 leaf inoculated wit... 42 0.026
gb|CX184618.1|CX184618 H11_45-78_15.ab1 leaf inoculated wit... 42 0.026
gb|CX184632.1|CX184632 A07_45-53_01.ab1 leaf inoculated wit... 42 0.026
gb|CX184705.1|CX184705 B01_45-98_03.ab1 leaf inoculated wit... 42 0.026
gb|CX184791.1|CX184791 B07_45-97_03.ab1 leaf inoculated wit... 42 0.026
gb|CX185007.1|CX185007 F07_45-99_11.ab1 leaf inoculated wit... 42 0.026
gb|CX185139.1|CX185139 E01_45-124_09.ab1 leaf inoculated wi... 42 0.026
gb|CX185166.1|CX185166 F12_45-53_12.ab1 leaf inoculated wit... 42 0.026
gb|CX185416.1|CX185416 D11_45-97_07.ab1 leaf inoculated wit... 42 0.026
gb|CX185517.1|CX185517 F03_45-65_11.ab1 leaf inoculated wit... 42 0.026
gb|CX185769.1|CX185769 F10_45-70_12.ab1 leaf inoculated wit... 42 0.026
gb|CX185855.1|CX185855 B05_45-41_03.ab1 leaf inoculated wit... 42 0.026
gb|CX186065.1|CX186065 B07_45-75_03.ab1 leaf inoculated wit... 42 0.026
gb|CX186150.1|CX186150 F03_45-107_11.ab1 leaf inoculated wi... 42 0.026
gb|CX186312.1|CX186312 D03_45-35_07.ab1 leaf inoculated wit... 42 0.026
gb|CX186331.1|CX186331 F07_45-64_11.ab1 leaf inoculated wit... 42 0.026
gb|CX186374.1|CX186374 H09_45-70_15.ab1 leaf inoculated wit... 42 0.026
gb|CX186387.1|CX186387 B03_45-71_03.ab1 leaf inoculated wit... 42 0.026
gb|CX186946.1|CX186946 E12_45-64_10.ab1 leaf inoculated wit... 42 0.026
gb|CX187175.1|CX187175 F12_45-95_12.ab1 leaf inoculated wit... 42 0.026
gb|CX187239.1|CX187239 B10_45-117_04.ab1 leaf inoculated wi... 42 0.026
gb|CX187270.1|CX187270 F11_45-66_11.ab1 leaf inoculated wit... 42 0.026
gb|CX187387.1|CX187387 C01_45-98_05.ab1 leaf inoculated wit... 42 0.026
gb|CX167486.1|CX167486 E01_69-122_09.ab1 leaf inoculated wi... 40 0.10
gb|CX167501.1|CX167501 H10_69-15_16.ab1 leaf inoculated wit... 40 0.10
gb|CX167531.1|CX167531 D11_69-22_07.ab1 leaf inoculated wit... 40 0.10
gb|CX167652.1|CX167652 E02_69-57_10.ab1 leaf inoculated wit... 40 0.10
gb|CX167801.1|CX167801 C03_69-120_05.ab1 leaf inoculated wi... 40 0.10
gb|CX168144.1|CX168144 B07_69-121_03.ab1 leaf inoculated wi... 40 0.10
gb|CX168213.1|CX168213 F07_69-28_11.ab1 leaf inoculated wit... 40 0.10
gb|CX168247.1|CX168247 H09_69-34_15.ab1 leaf inoculated wit... 40 0.10
gb|CX168276.1|CX168276 F07_69-15_11.ab1 leaf inoculated wit... 40 0.10
gb|CX168386.1|CX168386 G12_69-43_14.ab1 leaf inoculated wit... 40 0.10
gb|CX168568.1|CX168568 H11_69-62_15.ab1 leaf inoculated wit... 40 0.10
gb|CX168630.1|CX168630 E08_69-81_10.ab1 leaf inoculated wit... 40 0.10
gb|CX168909.1|CX168909 H01_69-22_15.ab1 leaf inoculated wit... 40 0.10
gb|CX169024.1|CX169024 B07_69-34_03.ab1 leaf inoculated wit... 40 0.10
gb|CX169058.1|CX169058 E07_69-46_09.ab1 leaf inoculated wit... 40 0.10
gb|CX169129.1|CX169129 F12_69-33_12.ab1 leaf inoculated wit... 40 0.10
gb|CX169233.1|CX169233 H03_69-39_15.ab1 leaf inoculated wit... 40 0.10
gb|CX169274.1|CX169274 H09_69-42_15.ab1 leaf inoculated wit... 40 0.10
gb|CX169331.1|CX169331 D11_69-81_07.ab1 leaf inoculated wit... 40 0.10
gb|CX169543.1|CX169543 G12_69-34_14.ab1 leaf inoculated wit... 40 0.10
gb|CX169609.1|CX169609 H06_69-59_16.ab1 leaf inoculated wit... 40 0.10
gb|CX169742.1|CX169742 B05_69-34_03.ab1 leaf inoculated wit... 40 0.10
gb|CX169789.1|CX169789 F10_69-46_12.ab1 leaf inoculated wit... 40 0.10
gb|CX170051.1|CX170051 E04_69-81_10.ab1 leaf inoculated wit... 40 0.10
gb|CX170548.1|CX170548 E10_69-36_10.ab1 leaf inoculated wit... 40 0.10
gb|CX170812.1|CX170812 E06_69-25_10.ab1 leaf inoculated wit... 40 0.10
gb|CX171048.1|CX171048 H07_69-59_15.ab1 leaf inoculated wit... 40 0.10
gb|CX171103.1|CX171103 E11_69-43_09.ab1 leaf inoculated wit... 40 0.10
gb|CX171148.1|CX171148 C10_69-36_06.ab1 leaf inoculated wit... 40 0.10
gb|CX171240.1|CX171240 G04_69-23_14.ab1 leaf inoculated wit... 40 0.10
gb|CX171368.1|CX171368 C02_69-81_06.ab1 leaf inoculated wit... 40 0.10
gb|CX171537.1|CX171537 E10_69-57_10.ab1 leaf inoculated wit... 40 0.10
gb|CX171555.1|CX171555 F08_69-34_12.ab1 leaf inoculated wit... 40 0.10
gb|CX171609.1|CX171609 E03_69-41_09.ab1 leaf inoculated wit... 40 0.10
gb|CX171801.1|CX171801 H05_69-46_15.ab1 leaf inoculated wit... 40 0.10
gb|CX172750.1|CX172750 D10_69-15_08.ab1 leaf inoculated wit... 40 0.10
gb|CX172849.1|CX172849 G08_69-60_14.ab1 leaf inoculated wit... 40 0.10
gb|CX172864.1|CX172864 E03_69-15_09.ab1 leaf inoculated wit... 40 0.10
gb|CX172977.1|CX172977 D12_69-40_08.ab1 leaf inoculated wit... 40 0.10
gb|CX173030.1|CX173030 G08_69-39_14.ab1 leaf inoculated wit... 40 0.10
gb|CX173079.1|CX173079 H11_69-116_15.ab1 leaf inoculated wi... 40 0.10
gb|CX173235.1|CX173235 D04_69-81_08.ab1 leaf inoculated wit... 40 0.10
gb|CX173441.1|CX173441 C01_69-81_05.ab1 leaf inoculated wit... 40 0.10
gb|CX173633.1|CX173633 F07_69-34_11.ab1 leaf inoculated wit... 40 0.10
gb|CX173952.1|CX173952 C03_69-68_05.ab1 leaf inoculated wit... 40 0.10
gb|CX174048.1|CX174048 F05_69-81_11.ab1 leaf inoculated wit... 40 0.10
gb|CX174328.1|CX174328 F06_69-59_12.ab1 leaf inoculated wit... 40 0.10
gb|CX174618.1|CX174618 G10_69-45_14.ab1 leaf inoculated wit... 40 0.10
gb|CX174660.1|CX174660 D05_69-81_07.ab1 leaf inoculated wit... 40 0.10
gb|CX174779.1|CX174779 F03_69-81_11.ab1 leaf inoculated wit... 40 0.10
gb|CX175098.1|CX175098 F03_69-34_11.ab1 leaf inoculated wit... 40 0.10
gb|CX175381.1|CX175381 E06_69-116_10.ab1 leaf inoculated wi... 40 0.10
gb|CX175553.1|CX175553 G09_69-34_13.ab1 leaf inoculated wit... 40 0.10
gb|CX175567.1|CX175567 G04_69-34_14.ab1 leaf inoculated wit... 40 0.10
gb|CX175798.1|CX175798 G05_69-43_13.ab1 leaf inoculated wit... 40 0.10
gb|CX176237.1|CX176237 G07_69-34_13.ab1 leaf inoculated wit... 40 0.10
gb|CX176275.1|CX176275 H06_69-43_16.ab1 leaf inoculated wit... 40 0.10
gb|CX176539.1|CX176539 B11_69-33_03.ab1 leaf inoculated wit... 40 0.10
gb|CX176624.1|CX176624 C11_69-81_05.ab1 leaf inoculated wit... 40 0.10
gb|CX176903.1|CX176903 B03_69-57_03.ab1 leaf inoculated wit... 40 0.10
gb|CX176967.1|CX176967 H09_69-43_15.ab1 leaf inoculated wit... 40 0.10
gb|CX177711.1|CX177711 E10_45-106_10.ab1 leaf inoculated wi... 40 0.10
gb|CX177882.1|CX177882 A07_45-56_01.ab1 leaf inoculated wit... 40 0.10
gb|CX177976.1|CX177976 C04_45-58_06.ab1 leaf inoculated wit... 40 0.10
gb|CX178285.1|CX178285 F12_45-73_12.ab1 leaf inoculated wit... 40 0.10
gb|CX178289.1|CX178289 G10_45-106_14.ab1 leaf inoculated wi... 40 0.10
gb|CX178461.1|CX178461 E03_45-95_09.ab1 leaf inoculated wit... 40 0.10
gb|CX178568.1|CX178568 F03_45-98_11.ab1 leaf inoculated wit... 40 0.10
gb|CX178613.1|CX178613 H04_45-52_16.ab1 leaf inoculated wit... 40 0.10
gb|CX178674.1|CX178674 G02_45-94_14.ab1 leaf inoculated wit... 40 0.10
gb|CX179173.1|CX179173 D03_45-98_07.ab1 leaf inoculated wit... 40 0.10
gb|CX179191.1|CX179191 E01_45-95_09.ab1 leaf inoculated wit... 40 0.10
gb|CX179260.1|CX179260 B08_45-94_04.ab1 leaf inoculated wit... 40 0.10
gb|CX179473.1|CX179473 F08_45-96_12.ab1 leaf inoculated wit... 40 0.10
gb|CX179496.1|CX179496 H06_45-107_16.ab1 leaf inoculated wi... 40 0.10
gb|CX179663.1|CX179663 D05_45-80_07.ab1 leaf inoculated wit... 40 0.10
gb|CX179676.1|CX179676 H04_45-69_16.ab1 leaf inoculated wit... 40 0.10
gb|CX179801.1|CX179801 E06_45-95_10.ab1 leaf inoculated wit... 40 0.10
gb|CX179907.1|CX179907 D01_45-98_07.ab1 leaf inoculated wit... 40 0.10
gb|CX180214.1|CX180214 F10_45-64_12.ab1 leaf inoculated wit... 40 0.10
gb|CX180541.1|CX180541 B12_45-40_04.ab1 leaf inoculated wit... 40 0.10
gb|CX180623.1|CX180623 G06_45-97_14.ab1 leaf inoculated wit... 40 0.10
gb|CX180859.1|CX180859 G01_45-94_13.ab1 leaf inoculated wit... 40 0.10
gb|CX180968.1|CX180968 C02_45-124_06.ab1 leaf inoculated wi... 40 0.10
gb|CX181114.1|CX181114 H05_45-69_15.ab1 leaf inoculated wit... 40 0.10
gb|CX181175.1|CX181175 F09_45-53_11.ab1 leaf inoculated wit... 40 0.10
gb|CX181382.1|CX181382 H11_45-58_15.ab1 leaf inoculated wit... 40 0.10
gb|CX181464.1|CX181464 G09_45-71_13.ab1 leaf inoculated wit... 40 0.10
gb|CX181478.1|CX181478 B11_45-58_03.ab1 leaf inoculated wit... 40 0.10
gb|CX181487.1|CX181487 C09_45-35_05.ab1 leaf inoculated wit... 40 0.10
gb|CX181766.1|CX181766 C06_45-56_06.ab1 leaf inoculated wit... 40 0.10
gb|CX181768.1|CX181768 D09_45-53_07.ab1 leaf inoculated wit... 40 0.10
gb|CX181828.1|CX181828 E03_45-98_09.ab1 leaf inoculated wit... 40 0.10
gb|CX182257.1|CX182257 H11_45-96_15.ab1 leaf inoculated wit... 40 0.10
gb|CX182459.1|CX182459 B06_45-120_04.ab1 leaf inoculated wi... 40 0.10
gb|CX182537.1|CX182537 F04_45-107_12.ab1 leaf inoculated wi... 40 0.10
gb|CX182695.1|CX182695 F11_45-72_11.ab1 leaf inoculated wit... 40 0.10
gb|CX182980.1|CX182980 B02_45-119_04.ab1 leaf inoculated wi... 40 0.10
gb|CX183203.1|CX183203 C07_45-56_05.ab1 leaf inoculated wit... 40 0.10
gb|CX183368.1|CX183368 E05_45-97_09.ab1 leaf inoculated wit... 40 0.10
gb|CX183410.1|CX183410 F03_45-40_11.ab1 leaf inoculated wit... 40 0.10
gb|CX183428.1|CX183428 G02_45-58_14.ab1 leaf inoculated wit... 40 0.10
gb|CX183592.1|CX183592 H06_45-41_16.ab1 leaf inoculated wit... 40 0.10
gb|CX183766.1|CX183766 G09_45-66_13.ab1 leaf inoculated wit... 40 0.10
gb|CX184121.1|CX184121 C11_45-58_05.ab1 leaf inoculated wit... 40 0.10
gb|CX184414.1|CX184414 F04_45-73_12.ab1 leaf inoculated wit... 40 0.10
gb|CX184467.1|CX184467 C04_45-98_06.ab1 leaf inoculated wit... 40 0.10
gb|CX184598.1|CX184598 F05_45-95_11.ab1 leaf inoculated wit... 40 0.10
gb|CX184620.1|CX184620 D12_45-58_08.ab1 leaf inoculated wit... 40 0.10
gb|CX184677.1|CX184677 E12_45-65_10.ab1 leaf inoculated wit... 40 0.10
gb|CX184788.1|CX184788 H08_45-96_16.ab1 leaf inoculated wit... 40 0.10
gb|CX184814.1|CX184814 E01_45-97_09.ab1 leaf inoculated wit... 40 0.10
gb|CX184942.1|CX184942 B02_45-71_04.ab1 leaf inoculated wit... 40 0.10
gb|CX185075.1|CX185075 G04_45-106_14.ab1 leaf inoculated wi... 40 0.10
gb|CX185218.1|CX185218 D05_45-95_07.ab1 leaf inoculated wit... 40 0.10
gb|CX185230.1|CX185230 E10_45-95_10.ab1 leaf inoculated wit... 40 0.10
gb|CX185345.1|CX185345 F03_45-95_11.ab1 leaf inoculated wit... 40 0.10
gb|CX185374.1|CX185374 A05_45-53_01.ab1 leaf inoculated wit... 40 0.10
gb|CX185865.1|CX185865 A08_45-56_02.ab1 leaf inoculated wit... 40 0.10
gb|CX186234.1|CX186234 H09_45-96_15.ab1 leaf inoculated wit... 40 0.10
gb|CX186562.1|CX186562 G02_45-95_14.ab1 leaf inoculated wit... 40 0.10
gb|CX186662.1|CX186662 D01_45-95_07.ab1 leaf inoculated wit... 40 0.10
gb|CX186696.1|CX186696 G12_45-58_14.ab1 leaf inoculated wit... 40 0.10
gb|CX187053.1|CX187053 D01_45-35_07.ab1 leaf inoculated wit... 40 0.10
gb|CX187164.1|CX187164 D04_45-98_08.ab1 leaf inoculated wit... 40 0.10
gb|CX187233.1|CX187233 E03_45-113_09.ab1 leaf inoculated wi... 40 0.10
gb|CX187299.1|CX187299 D09_45-72_07.ab1 leaf inoculated wit... 40 0.10
gb|CX187479.1|CX187479 G05_45-65_13.ab1 leaf inoculated wit... 40 0.10
gb|DV463887.1|DV463887 MTUNUL1.P20.F06 NUL Populus fremonti... 40 0.10
gb|CX167960.1|CX167960 D10_69-81_08.ab1 leaf inoculated wit... 38 0.41
gb|CX168919.1|CX168919 E08_69-34_10.ab1 leaf inoculated wit... 38 0.41
gb|CX169299.1|CX169299 G05_69-29_13.ab1 leaf inoculated wit... 38 0.41
gb|CX169741.1|CX169741 H06_69-33_16.ab1 leaf inoculated wit... 38 0.41
gb|CX170148.1|CX170148 C05_69-35_05.ab1 leaf inoculated wit... 38 0.41
gb|CX170336.1|CX170336 A10_69-34_02.ab1 leaf inoculated wit... 38 0.41
gb|CX170387.1|CX170387 F08_69-43_12.ab1 leaf inoculated wit... 38 0.41
gb|CX170401.1|CX170401 F01_69-15_11.ab1 leaf inoculated wit... 38 0.41
gb|CX170701.1|CX170701 E09_69-28_09.ab1 leaf inoculated wit... 38 0.41
gb|CX172431.1|CX172431 H03_69-59_15.ab1 leaf inoculated wit... 38 0.41
gb|CX172440.1|CX172440 E04_69-50_10.ab1 leaf inoculated wit... 38 0.41
gb|CX172591.1|CX172591 H09_69-120_15.ab1 leaf inoculated wi... 38 0.41
gb|CX173202.1|CX173202 H01_69-46_15.ab1 leaf inoculated wit... 38 0.41
gb|CX173365.1|CX173365 F06_69-121_12.ab1 leaf inoculated wi... 38 0.41
gb|CX174283.1|CX174283 G09_69-60_13.ab1 leaf inoculated wit... 38 0.41
gb|CX174710.1|CX174710 D09_69-25_07.ab1 leaf inoculated wit... 38 0.41
gb|CX174717.1|CX174717 H03_69-45_15.ab1 leaf inoculated wit... 38 0.41
gb|CX175226.1|CX175226 C09_69-58_05.ab1 leaf inoculated wit... 38 0.41
gb|CX175656.1|CX175656 A09_69-34_01.ab1 leaf inoculated wit... 38 0.41
gb|CX176095.1|CX176095 A12_69-57_02.ab1 leaf inoculated wit... 38 0.41
gb|CX176163.1|CX176163 C02_69-15_06.ab1 leaf inoculated wit... 38 0.41
gb|CX176358.1|CX176358 D07_69-46_07.ab1 leaf inoculated wit... 38 0.41
gb|CX177002.1|CX177002 B04_69-56_04.ab1 leaf inoculated wit... 38 0.41
gb|CX177215.1|CX177215 E10_69-20_10.ab1 leaf inoculated wit... 38 0.41
gb|CX177289.1|CX177289 F04_69-45_12.ab1 leaf inoculated wit... 38 0.41
gb|CX177534.1|CX177534 C08_45-79_06.ab1 leaf inoculated wit... 38 0.41
gb|CX177857.1|CX177857 G03_45-95_13.ab1 leaf inoculated wit... 38 0.41
gb|CX178458.1|CX178458 E10_45-98_10.ab1 leaf inoculated wit... 38 0.41
gb|CX178508.1|CX178508 G05_45-56_13.ab1 leaf inoculated wit... 38 0.41
gb|CX178585.1|CX178585 C02_45-75_06.ab1 leaf inoculated wit... 38 0.41
gb|CX178836.1|CX178836 C09_45-96_05.ab1 leaf inoculated wit... 38 0.41
gb|CX179003.1|CX179003 A05_45-123_01.ab1 leaf inoculated wi... 38 0.41
gb|CX179099.1|CX179099 D07_45-59_07.ab1 leaf inoculated wit... 38 0.41
gb|CX179101.1|CX179101 B06_45-56_04.ab1 leaf inoculated wit... 38 0.41
gb|CX179643.1|CX179643 F07_45-54_11.ab1 leaf inoculated wit... 38 0.41
gb|CX179723.1|CX179723 D06_45-113_08.ab1 leaf inoculated wi... 38 0.41
gb|CX179841.1|CX179841 E10_45-59_10.ab1 leaf inoculated wit... 38 0.41
gb|CX180416.1|CX180416 A02_45-124_02.ab1 leaf inoculated wi... 38 0.41
gb|CX180420.1|CX180420 C06_45-95_06.ab1 leaf inoculated wit... 38 0.41
gb|CX180439.1|CX180439 G10_45-95_14.ab1 leaf inoculated wit... 38 0.41
gb|CX180554.1|CX180554 E03_45-103_09.ab1 leaf inoculated wi... 38 0.41
gb|CX180704.1|CX180704 A10_45-65_02.ab1 leaf inoculated wit... 38 0.41
gb|CX180931.1|CX180931 D06_45-79_08.ab1 leaf inoculated wit... 38 0.41
gb|CX181047.1|CX181047 E09_45-59_09.ab1 leaf inoculated wit... 38 0.41
gb|CX181276.1|CX181276 C03_45-53_05.ab1 leaf inoculated wit... 38 0.41
gb|CX181445.1|CX181445 G12_45-103_14.ab1 leaf inoculated wi... 38 0.41
gb|CX181725.1|CX181725 H09_45-98_15.ab1 leaf inoculated wit... 38 0.41
gb|CX182225.1|CX182225 E06_45-64_10.ab1 leaf inoculated wit... 38 0.41
gb|CX182384.1|CX182384 G08_45-53_14.ab1 leaf inoculated wit... 38 0.41
gb|CX182570.1|CX182570 E01_45-98_09.ab1 leaf inoculated wit... 38 0.41
gb|CX182895.1|CX182895 D04_45-57_08.ab1 leaf inoculated wit... 38 0.41
gb|CX183033.1|CX183033 D06_45-120_08.ab1 leaf inoculated wi... 38 0.41
gb|CX183103.1|CX183103 D10_45-59_08.ab1 leaf inoculated wit... 38 0.41
gb|CX183145.1|CX183145 C02_45-69_06.ab1 leaf inoculated wit... 38 0.41
gb|CX183211.1|CX183211 C02_45-56_06.ab1 leaf inoculated wit... 38 0.41
gb|CX183489.1|CX183489 G03_45-97_13.ab1 leaf inoculated wit... 38 0.41
gb|CX183714.1|CX183714 H09_45-112_15.ab1 leaf inoculated wi... 38 0.41
gb|CX184440.1|CX184440 C03_45-86_05.ab1 leaf inoculated wit... 38 0.41
gb|CX184471.1|CX184471 F07_45-113_11.ab1 leaf inoculated wi... 38 0.41
gb|CX184732.1|CX184732 E05_45-58_09.ab1 leaf inoculated wit... 38 0.41
gb|CX184763.1|CX184763 F10_45-103_12.ab1 leaf inoculated wi... 38 0.41
gb|CX184780.1|CX184780 F05_45-106_11.ab1 leaf inoculated wi... 38 0.41
gb|CX185097.1|CX185097 D09_45-60_07.ab1 leaf inoculated wit... 38 0.41
gb|CX185215.1|CX185215 C02_45-98_06.ab1 leaf inoculated wit... 38 0.41
gb|CX185451.1|CX185451 F03_45-78_11.ab1 leaf inoculated wit... 38 0.41
gb|CX185545.1|CX185545 F04_45-77_12.ab1 leaf inoculated wit... 38 0.41
gb|CX185741.1|CX185741 E05_45-79_09.ab1 leaf inoculated wit... 38 0.41
gb|CX185887.1|CX185887 E05_45-53_09.ab1 leaf inoculated wit... 38 0.41
gb|CX186572.1|CX186572 G12_45-75_14.ab1 leaf inoculated wit... 38 0.41
gb|CX186756.1|CX186756 D10_45-100_08.ab1 leaf inoculated wi... 38 0.41
gb|CX186921.1|CX186921 A08_45-64_02.ab1 leaf inoculated wit... 38 0.41
gb|CX187182.1|CX187182 B07_45-79_03.ab1 leaf inoculated wit... 38 0.41
gb|CX187279.1|CX187279 C11_45-95_05.ab1 leaf inoculated wit... 38 0.41
gb|CX187310.1|CX187310 E08_45-123_10.ab1 leaf inoculated wi... 38 0.41
gb|CX187330.1|CX187330 D03_45-56_07.ab1 leaf inoculated wit... 38 0.41
gb|CX187484.1|CX187484 C02_45-97_06.ab1 leaf inoculated wit... 38 0.41
>gb|CX187326.1|CX187326 B07_45-53_03.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 605
Score = 52.0 bits (26), Expect = 3e-005
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcgctccctcc 30
|||||||||||||||||| |||||||||||
Sbjct: 8 ccaaagaattcggcacgatgcgctccctcc 37
>gb|CV244991.1|CV244991 WS0256.B21_D04 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS0256_D04 3', mRNA sequence
Length = 927
Score = 50.1 bits (25), Expect = 1e-004
Identities = 64/77 (83%)
Strand = Plus / Minus
Query: 561 cctgaaagatgcaacgtctattccttctgcaagaccttgactgcttcagatacaagtacc 620
||||||||||||| ||| |||| || |||||||| | |||||||| || ||||| ||
Sbjct: 625 cctgaaagatgcacggtccattcattttgcaagacacttactgcttctgacacaagcact 566
Query: 621 catggtggattctctgt 637
|||||||| ||||||||
Sbjct: 565 catggtggtttctctgt 549
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 354 ggtcatatggaacagcttgaagcatc 379
||||| ||||||||||||||||||||
Sbjct: 832 ggtcacatggaacagcttgaagcatc 807
>gb|CV256321.1|CV256321 WS0243.B21_I14 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0243_I14 3', mRNA sequence
Length = 898
Score = 50.1 bits (25), Expect = 1e-004
Identities = 64/77 (83%)
Strand = Plus / Plus
Query: 561 cctgaaagatgcaacgtctattccttctgcaagaccttgactgcttcagatacaagtacc 620
||||||||||||| ||| |||| || |||||||| | |||||||| || ||||| ||
Sbjct: 439 cctgaaagatgcacggtccattcattttgcaagacacttactgcttctgacacaagcact 498
Query: 621 catggtggattctctgt 637
|||||||| ||||||||
Sbjct: 499 catggtggtttctctgt 515
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 354 ggtcatatggaacagcttgaagcatc 379
||||| ||||||||||||||||||||
Sbjct: 232 ggtcacatggaacagcttgaagcatc 257
>gb|BI138460.1|BI138460 F106P90Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 499
Score = 44.1 bits (22), Expect = 0.007
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 598 tgactgcttcagatacaagtacccatggtggatt 631
|||||||||| ||||| ||||| |||||||||||
Sbjct: 205 tgactgcttcggataccagtactcatggtggatt 238
>gb|CX169926.1|CX169926 H11_69-23_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 617
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcg 22
||||||||||||||||||||||
Sbjct: 6 ccaaagaattcggcacgacgcg 27
>gb|CX172797.1|CX172797 E03_69-28_09.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 671
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcg 22
||||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgcg 30
>gb|CX176885.1|CX176885 G06_69-59_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 414
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcg 22
||||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgcg 29
>gb|CX177176.1|CX177176 H10_69-45_16.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 548
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcg 22
||||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgcg 29
>gb|CX177743.1|CX177743 E05_45-95_09.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 635
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcgctcc 26
||||||||||||||||||||| ||||
Sbjct: 8 ccaaagaattcggcacgacgctctcc 33
>gb|CX177748.1|CX177748 D05_45-107_07.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 619
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcg 22
||||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgcg 29
>gb|CX179436.1|CX179436 B02_45-52_04.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 606
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcg 22
||||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgcg 30
>gb|CX180955.1|CX180955 G12_45-73_14.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 563
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcg 22
||||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgcg 30
>gb|CX181832.1|CX181832 C02_45-95_06.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 671
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcg 22
||||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgcg 29
>gb|CX182029.1|CX182029 A12_45-94_02.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 709
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcg 22
||||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgcg 30
>gb|BU821803.1|BU821803 UB28CPB01 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 398
Score = 42.1 bits (21), Expect = 0.026
Identities = 63/77 (81%)
Strand = Plus / Plus
Query: 561 cctgaaagatgcaacgtctattccttctgcaagaccttgactgcttcagatacaagtacc 620
|||||||||||| ||| |||| || |||||||| | |||||||| || ||||| ||
Sbjct: 33 cctgaaagatgcgcggtccattcattttgcaagacacttactgcttctgacacaagcact 92
Query: 621 catggtggattctctgt 637
|||||||| ||||||||
Sbjct: 93 catggtggtttctctgt 109
>gb|CK106655.1|CK106655 UB28CPB01.5pR Populus active cambium cDNA library Populus tremula
cDNA clone UB28CPB01 5', mRNA sequence
Length = 613
Score = 42.1 bits (21), Expect = 0.026
Identities = 63/77 (81%)
Strand = Plus / Plus
Query: 561 cctgaaagatgcaacgtctattccttctgcaagaccttgactgcttcagatacaagtacc 620
|||||||||||| ||| |||| || |||||||| | |||||||| || ||||| ||
Sbjct: 14 cctgaaagatgcgcggtccattcattttgcaagacacttactgcttctgacacaagcact 73
Query: 621 catggtggattctctgt 637
|||||||| ||||||||
Sbjct: 74 catggtggtttctctgt 90
>gb|CX167789.1|CX167789 G03_69-34_13.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 677
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX168069.1|CX168069 D03_69-120_07.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 712
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX168157.1|CX168157 D09_69-15_07.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 681
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX168270.1|CX168270 G12_69-60_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 506
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX168285.1|CX168285 F02_69-15_12.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 662
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX169627.1|CX169627 A12_69-34_02.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 622
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX169638.1|CX169638 E06_69-34_10.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 675
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX169916.1|CX169916 C10_69-58_06.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 760
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgc 28
>gb|CX169937.1|CX169937 C06_69-81_06.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 607
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX170948.1|CX170948 C09_69-34_05.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 691
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX171108.1|CX171108 C10_69-40_06.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 661
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 6 ccaaagaattcggcacgacgc 26
>gb|CX171302.1|CX171302 E07_69-45_09.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 663
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX171358.1|CX171358 C07_69-81_05.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 594
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX171655.1|CX171655 G11_69-34_13.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 592
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX171758.1|CX171758 G12_69-33_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 696
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 5 ccaaagaattcggcacgacgc 25
>gb|CX171865.1|CX171865 A01_69-37_01.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 691
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX171954.1|CX171954 B03_69-1_03.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 662
Score = 42.1 bits (21), Expect = 0.026
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcgctc 25
|||||||||||||||||| ||||||
Sbjct: 4 ccaaagaattcggcacgaggcgctc 28
>gb|CX172038.1|CX172038 A09_69-122_01.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 728
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 3 ccaaagaattcggcacgacgc 23
>gb|CX172206.1|CX172206 H03_69-93_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 167
Score = 42.1 bits (21), Expect = 0.026
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcgctc 25
|||||||||||||||||| ||||||
Sbjct: 5 ccaaagaattcggcacgaggcgctc 29
>gb|CX172248.1|CX172248 D04_69-69_08.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 676
Score = 42.1 bits (21), Expect = 0.026
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcgctc 25
|||||||||||||||||| ||||||
Sbjct: 9 ccaaagaattcggcacgaggcgctc 33
>gb|CX172522.1|CX172522 D06_69-81_08.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 608
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX172616.1|CX172616 G05_69-23_13.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 591
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgc 28
>gb|CX172975.1|CX172975 H11_69-60_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 680
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgc 28
>gb|CX173397.1|CX173397 F06_69-25_12.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 605
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 5 ccaaagaattcggcacgacgc 25
>gb|CX173813.1|CX173813 E03_69-122_09.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 717
Score = 42.1 bits (21), Expect = 0.026
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgcgctc 25
|||||||||||||||||| ||||||
Sbjct: 9 ccaaagaattcggcacgaggcgctc 33
>gb|CX173915.1|CX173915 B04_69-116_04.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 578
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX174135.1|CX174135 G08_69-34_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 640
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX174395.1|CX174395 F06_69-46_12.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 618
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgc 28
>gb|CX174398.1|CX174398 G09_69-43_13.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 600
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgc 28
>gb|CX174410.1|CX174410 G04_69-43_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 706
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX174539.1|CX174539 H07_69-23_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 717
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 8 ccaaagaattcggcacgacgc 28
>gb|CX174558.1|CX174558 F07_69-112_11.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 596
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX174863.1|CX174863 G06_69-34_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 697
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
>gb|CX175041.1|CX175041 G11_69-24_13.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 702
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 ccaaagaattcggcacgacgc 21
|||||||||||||||||||||
Sbjct: 9 ccaaagaattcggcacgacgc 29
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 81,762
Number of Sequences: 369679
Number of extensions: 81762
Number of successful extensions: 32568
Number of sequences better than 0.5: 329
Number of HSP's better than 0.5 without gapping: 329
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32130
Number of HSP's gapped (non-prelim): 438
length of query: 660
length of database: 203,408,664
effective HSP length: 19
effective length of query: 641
effective length of database: 196,384,763
effective search space: 125882633083
effective search space used: 125882633083
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)