BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2647492.2.1
(1179 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU826541.1|BU826541 UK121TH02 Populus apical shoot cDNA ... 52 5e-005
gb|CA821774.1|CA821774 RSH07C07 two-month-old roots from cl... 52 5e-005
gb|CX176657.1|CX176657 G06_69-93_14.ab1 leaf inoculated wit... 52 5e-005
gb|CX658788.1|CX658788 PO01022C11 Poplar SC cDNA library Po... 52 5e-005
gb|DV464303.1|DV464303 MTUNUL1.P25.G10 NUL Populus fremonti... 52 5e-005
gb|DV465811.1|DV465811 MTUNUL1.P43.D11 NUL Populus fremonti... 52 5e-005
gb|BU883066.1|BU883066 UM85TH10 Populus flower cDNA library... 46 0.003
gb|CN550220.1|CN550220 GQ0242.B3_D22 GQ024 Populus trichoca... 46 0.003
gb|DN501330.1|DN501330 UM85TH10.5pR Populus female catkins ... 46 0.003
gb|BU889347.1|BU889347 P019F12 Populus petioles cDNA librar... 42 0.048
gb|CF230550.1|CF230550 PtaC0009G12G1214 Poplar cDNA library... 42 0.048
gb|BU888176.1|BU888176 P004F08 Populus petioles cDNA librar... 40 0.19
>gb|BU826541.1|BU826541 UK121TH02 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 630
Score = 52.0 bits (26), Expect = 5e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 965 acaacattgctgcaataaacaggatg 990
||||||||||||||||||||||||||
Sbjct: 406 acaacattgctgcaataaacaggatg 381
Score = 42.1 bits (21), Expect = 0.048
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 815 ccatactcatcccagccactcttga 839
|||||||||||||| ||||||||||
Sbjct: 556 ccatactcatcccaaccactcttga 532
>gb|CA821774.1|CA821774 RSH07C07 two-month-old roots from clone 'Beaupre' grown for 19 days
under restricted irrigation Populus trichocarpa x
Populus deltoides cDNA 5', mRNA sequence
Length = 590
Score = 52.0 bits (26), Expect = 5e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 965 acaacattgctgcaataaacaggatg 990
||||||||||||||||||||||||||
Sbjct: 304 acaacattgctgcaataaacaggatg 279
>gb|CX176657.1|CX176657 G06_69-93_14.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 596
Score = 52.0 bits (26), Expect = 5e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 965 acaacattgctgcaataaacaggatg 990
||||||||||||||||||||||||||
Sbjct: 204 acaacattgctgcaataaacaggatg 179
>gb|CX658788.1|CX658788 PO01022C11 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01022C11 5', mRNA sequence
Length = 697
Score = 52.0 bits (26), Expect = 5e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 965 acaacattgctgcaataaacaggatg 990
||||||||||||||||||||||||||
Sbjct: 637 acaacattgctgcaataaacaggatg 612
>gb|DV464303.1|DV464303 MTUNUL1.P25.G10 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 869
Score = 52.0 bits (26), Expect = 5e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 965 acaacattgctgcaataaacaggatg 990
||||||||||||||||||||||||||
Sbjct: 661 acaacattgctgcaataaacaggatg 636
>gb|DV465811.1|DV465811 MTUNUL1.P43.D11 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 834
Score = 52.0 bits (26), Expect = 5e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 965 acaacattgctgcaataaacaggatg 990
||||||||||||||||||||||||||
Sbjct: 444 acaacattgctgcaataaacaggatg 419
>gb|BU883066.1|BU883066 UM85TH10 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 577
Score = 46.1 bits (23), Expect = 0.003
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 857 ccagtcgaaatgtagcaatcctcgatgcagatgttgctgctggaatctggatcaattcca 916
||||| |||||||| |||| || ||||||| ||| ||| ||||||||||||||||||
Sbjct: 195 ccagtggaaatgtatgaatcttctatgcagacgttagagcttgaatctggatcaattcca 136
Query: 917 tccgtgttggg 927
|| || |||||
Sbjct: 135 tcggtattggg 125
>gb|CN550220.1|CN550220 GQ0242.B3_D22 GQ024 Populus trichocarpa x Populus deltoides cDNA
clone GQ0242_D22 5', mRNA sequence
Length = 678
Score = 46.1 bits (23), Expect = 0.003
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 857 ccagtcgaaatgtagcaatcctcgatgcagatgttgctgctggaatctggatcaattcca 916
||||| |||||||| |||| || ||||||| ||| ||| ||||||||||||||||||
Sbjct: 305 ccagtggaaatgtatgaatcttctatgcagacgttagagcttgaatctggatcaattcca 246
Query: 917 tccgtgttggg 927
|| || |||||
Sbjct: 245 tcggtattggg 235
>gb|DN501330.1|DN501330 UM85TH10.5pR Populus female catkins cDNA library Populus
trichocarpa cDNA clone UM85TH10 5', mRNA sequence
Length = 697
Score = 46.1 bits (23), Expect = 0.003
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 857 ccagtcgaaatgtagcaatcctcgatgcagatgttgctgctggaatctggatcaattcca 916
||||| |||||||| |||| || ||||||| ||| ||| ||||||||||||||||||
Sbjct: 196 ccagtggaaatgtatgaatcttctatgcagacgttagagcttgaatctggatcaattcca 137
Query: 917 tccgtgttggg 927
|| || |||||
Sbjct: 136 tcggtattggg 126
>gb|BU889347.1|BU889347 P019F12 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 505
Score = 42.1 bits (21), Expect = 0.048
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 899 gaatctggatcaattccatccgtgttggg 927
|||||||||||||||||||| || |||||
Sbjct: 457 gaatctggatcaattccatcggtattggg 429
>gb|CF230550.1|CF230550 PtaC0009G12G1214 Poplar cDNA library from cambial zone Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 463
Score = 42.1 bits (21), Expect = 0.048
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 815 ccatactcatcccagccactcttgatggc 843
|||||||||||||| ||||| ||||||||
Sbjct: 359 ccatactcatcccacccacttttgatggc 331
>gb|BU888176.1|BU888176 P004F08 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 522
Score = 40.1 bits (20), Expect = 0.19
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 803 ccataggcgattccatactcatcccagccact 834
||||| || |||||||||| ||||||||||||
Sbjct: 72 ccatatgcaattccatactgatcccagccact 41
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 114,519
Number of Sequences: 369679
Number of extensions: 114519
Number of successful extensions: 32769
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32747
Number of HSP's gapped (non-prelim): 22
length of query: 1179
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1160
effective length of database: 196,384,763
effective search space: 227806325080
effective search space used: 227806325080
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)