BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2478113.2.1
         (796 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BU895248.1|BU895248  X021C06 Populus wood cDNA library Po...    38   0.50 
gb|CA926936.1|CA926936  MTU6CR.P3.A04 Aspen root cDNA Librar...    38   0.50 
gb|DN502501.1|DN502501  X021C06.5pR Populus wood cDNA librar...    38   0.50 

>gb|BU895248.1|BU895248 X021C06 Populus wood cDNA library Populus tremula x Populus
           tremuloides cDNA 5 prime, mRNA sequence
          Length = 698

 Score = 38.2 bits (19), Expect = 0.50
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 225 cgaggaacttgttcttgggcttg 247
           ||||||||||||||||| |||||
Sbjct: 70  cgaggaacttgttcttgtgcttg 48



>gb|CA926936.1|CA926936 MTU6CR.P3.A04 Aspen root cDNA Library Populus tremuloides cDNA,
           mRNA sequence
          Length = 466

 Score = 38.2 bits (19), Expect = 0.50
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 225 cgaggaacttgttcttgggcttg 247
           ||||||||||||||||| |||||
Sbjct: 108 cgaggaacttgttcttgtgcttg 130



>gb|DN502501.1|DN502501 X021C06.5pR Populus wood cDNA library Populus tremula x Populus
           tremuloides cDNA clone X021C06 5', mRNA sequence
          Length = 590

 Score = 38.2 bits (19), Expect = 0.50
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 225 cgaggaacttgttcttgggcttg 247
           ||||||||||||||||| |||||
Sbjct: 71  cgaggaacttgttcttgtgcttg 49



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 76,163
Number of Sequences: 369679
Number of extensions: 76163
Number of successful extensions: 20370
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20367
Number of HSP's gapped (non-prelim): 3
length of query: 796
length of database: 203,408,664
effective HSP length: 19
effective length of query: 777
effective length of database: 196,384,763
effective search space: 152590960851
effective search space used: 152590960851
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)