BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2478075.2.1
         (807 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BU835450.1|BU835450  T074A11 Populus apical shoot cDNA li...    42   0.032
gb|CK096703.1|CK096703  UB23CPG01.3pR Populus active cambium...    42   0.032

>gb|BU835450.1|BU835450 T074A11 Populus apical shoot cDNA library Populus tremula x Populus
           tremuloides cDNA 5 prime, mRNA sequence
          Length = 714

 Score = 42.1 bits (21), Expect = 0.032
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 40  tgtctacagtctcaagcttca 60
           |||||||||||||||||||||
Sbjct: 494 tgtctacagtctcaagcttca 514



>gb|CK096703.1|CK096703 UB23CPG01.3pR Populus active cambium cDNA library Populus tremula
           cDNA clone UB23CPG01 3', mRNA sequence
          Length = 848

 Score = 42.1 bits (21), Expect = 0.032
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 40  tgtctacagtctcaagcttca 60
           |||||||||||||||||||||
Sbjct: 720 tgtctacagtctcaagcttca 700



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 68,966
Number of Sequences: 369679
Number of extensions: 68966
Number of successful extensions: 16906
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16904
Number of HSP's gapped (non-prelim): 2
length of query: 807
length of database: 203,408,664
effective HSP length: 19
effective length of query: 788
effective length of database: 196,384,763
effective search space: 154751193244
effective search space used: 154751193244
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)