BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2448753.2.1
(537 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA928402.1|CA928402 MTU6TR.P2.C04 Aspen root cDNA Librar... 58 4e-007
gb|CA928427.1|CA928427 MTU6TR.P2.E09 Aspen root cDNA Librar... 58 4e-007
gb|AI165442.1|AI165442 A084P15U Hybrid aspen plasmid librar... 56 1e-006
gb|AI165789.1|AI165789 A091p48u Hybrid aspen plasmid librar... 56 1e-006
gb|BI128919.1|BI128919 G083P51Y Populus cambium cDNA librar... 56 1e-006
gb|BU827425.1|BU827425 K002P08P Populus apical shoot cDNA l... 56 1e-006
gb|BU833744.1|BU833744 T052A02 Populus apical shoot cDNA li... 56 1e-006
gb|CK099777.1|CK099777 A084P15.5pR Hybrid aspen plasmid lib... 56 1e-006
gb|CA929488.1|CA929488 MTU2CA.P14.E06 Aspen apex cDNA Libra... 52 2e-005
gb|BI138489.1|BI138489 F107P68Y Populus flower cDNA library... 48 3e-004
gb|BU810743.1|BU810743 UL74PG02 Populus leaf cDNA library P... 48 3e-004
gb|BU813395.1|BU813395 N009H11 Populus bark cDNA library Po... 48 3e-004
gb|BU817020.1|BU817020 UA11BPH11 Populus tremula cambium cD... 48 3e-004
gb|BU824801.1|BU824801 UK100A06 Populus apical shoot cDNA l... 48 3e-004
gb|BU825687.1|BU825687 UK111TH07 Populus apical shoot cDNA ... 48 3e-004
gb|BU826604.1|BU826604 UK122TF03 Populus apical shoot cDNA ... 48 3e-004
gb|BU828809.1|BU828809 K028P94P Populus apical shoot cDNA l... 48 3e-004
gb|BU828991.1|BU828991 K032P21P Populus apical shoot cDNA l... 48 3e-004
gb|BU830621.1|BU830621 T010H03 Populus apical shoot cDNA li... 48 3e-004
gb|BU832801.1|BU832801 T038D06 Populus apical shoot cDNA li... 48 3e-004
gb|BU834424.1|BU834424 T061A09 Populus apical shoot cDNA li... 48 3e-004
gb|BU834470.1|BU834470 T061F01 Populus apical shoot cDNA li... 48 3e-004
gb|BU835269.1|BU835269 T071G06 Populus apical shoot cDNA li... 48 3e-004
gb|BU836310.1|BU836310 T085C08 Populus apical shoot cDNA li... 48 3e-004
gb|BU836411.1|BU836411 T086C04 Populus apical shoot cDNA li... 48 3e-004
gb|BU836638.1|BU836638 T089A12 Populus apical shoot cDNA li... 48 3e-004
gb|BU836911.1|BU836911 T092D08 Populus apical shoot cDNA li... 48 3e-004
gb|BU836980.1|BU836980 T093C06 Populus apical shoot cDNA li... 48 3e-004
gb|BU837852.1|BU837852 T106D05 Populus apical shoot cDNA li... 48 3e-004
gb|BU871870.1|BU871870 Q035E05 Populus flower cDNA library ... 48 3e-004
gb|BU876518.1|BU876518 V021G02 Populus flower cDNA library ... 48 3e-004
gb|BU876936.1|BU876936 V027B11 Populus flower cDNA library ... 48 3e-004
gb|BU877414.1|BU877414 V033G03 Populus flower cDNA library ... 48 3e-004
gb|BU887209.1|BU887209 R056C04 Populus root cDNA library Po... 48 3e-004
gb|BU888180.1|BU888180 P004G02 Populus petioles cDNA librar... 48 3e-004
gb|BU888201.1|BU888201 P005A03 Populus petioles cDNA librar... 48 3e-004
gb|BU888300.1|BU888300 P006C05 Populus petioles cDNA librar... 48 3e-004
gb|BU888746.1|BU888746 P012A03 Populus petioles cDNA librar... 48 3e-004
gb|BU889151.1|BU889151 P017D02 Populus petioles cDNA librar... 48 3e-004
gb|BU889688.1|BU889688 P024D03 Populus petioles cDNA librar... 48 3e-004
gb|BU891317.1|BU891317 P048F06 Populus petioles cDNA librar... 48 3e-004
gb|BU892183.1|BU892183 P060E05 Populus petioles cDNA librar... 48 3e-004
gb|CA929637.1|CA929637 MTU2CA.P16.E05 Aspen apex cDNA Libra... 48 3e-004
gb|CA824338.1|CA824338 R40C10 two-month-old roots from clon... 48 3e-004
gb|CA824768.1|CA824768 R48B01 two-month-old roots from clon... 48 3e-004
gb|CF231976.1|CF231976 PtaJXO0005A4A0402 Poplar cDNA librar... 48 3e-004
gb|CK108120.1|CK108120 G102P75 Populus tension wood cDNA li... 48 3e-004
gb|CK113139.1|CK113139 UR103TD07 Populus root cDNA library ... 48 3e-004
gb|CN522385.1|CN522385 GQ0122.B3_E11 GQ012 Populus trichoca... 48 3e-004
gb|AJ774714.1|AJ774714 AJ774714 Populus euphratica shoot 3-... 48 3e-004
gb|AJ779512.1|AJ779512 AJ779512 Populus euphratica root 3-6... 48 3e-004
gb|CV227902.1|CV227902 WS0168.B21_I19 PT-DX-A-7 Populus tri... 48 3e-004
gb|CV237674.1|CV237674 WS0123.B21_K23 PT-GT-FL-A-3 Populus ... 48 3e-004
gb|CV265759.1|CV265759 WS02028.B21_C11 PTxN-IB-N-A-11 Popul... 48 3e-004
gb|CV266471.1|CV266471 WS0203.B21_C02 PTxN-IB-N-A-11 Populu... 48 3e-004
gb|CV267295.1|CV267295 WS02031.B21_F18 PTxN-IB-N-A-11 Popul... 48 3e-004
gb|CV283428.1|CV283428 WS0187.B21_F01 PTxD-IL-N-A-9 Populus... 48 3e-004
gb|CX170243.1|CX170243 H03_69-51_15.ab1 leaf inoculated wit... 48 3e-004
gb|CX180308.1|CX180308 A12_45-18_02.ab1 leaf inoculated wit... 48 3e-004
gb|CX653811.1|CX653811 PO02007E10 Poplar SC cDNA library Po... 48 3e-004
gb|CX654420.1|CX654420 PO02005B12 Poplar SC cDNA library Po... 48 3e-004
gb|DN483691.1|DN483691 PSO202B01 Populus tomentiglandulosa ... 48 3e-004
gb|DT473768.1|DT473768 WS0123.BR_K23 PT-GT-FL-A-3 Populus t... 48 3e-004
gb|DT507812.1|DT507812 WS02419.BR_E15 PTxD-ICC-N-A-14 Popul... 48 3e-004
gb|DT511984.1|DT511984 WS02418.B21_A17 PTxD-ICC-N-A-14 Popu... 48 3e-004
gb|DT512440.1|DT512440 WS02419.B21_E15 PTxD-ICC-N-A-14 Popu... 48 3e-004
gb|DT516064.1|DT516064 WS02430.B21_E22 PTxD-ICC-N-A-14 Popu... 48 3e-004
gb|DT517241.1|DT517241 WS02433.B21_L17 PTxD-ICC-N-A-14 Popu... 48 3e-004
gb|DT518991.1|DT518991 WS02439.B21_O21 PTxD-ICC-N-A-14 Popu... 48 3e-004
gb|DT525461.1|DT525461 WS02045.C21_G13 PTxN-IB-N-A-11 Popul... 48 3e-004
gb|BU812512.1|BU812512 UL97TC04 Populus leaf cDNA library P... 40 0.084
gb|BU867434.1|BU867434 M100A09 Populus flower cDNA library ... 40 0.084
gb|BU878101.1|BU878101 V043B06 Populus flower cDNA library ... 40 0.084
gb|BU878411.1|BU878411 V046H09 Populus flower cDNA library ... 40 0.084
gb|BU878854.1|BU878854 V052F06 Populus flower cDNA library ... 40 0.084
gb|BU890969.1|BU890969 P044B06 Populus petioles cDNA librar... 40 0.084
gb|BU892123.1|BU892123 P059F08 Populus petioles cDNA librar... 40 0.084
gb|CF228392.1|CF228392 PtaXM0012D7D0707 Poplar cDNA library... 40 0.084
gb|CF237233.1|CF237233 Ptajxtjxt3E9E0909 Poplar cDNA librar... 40 0.084
gb|CK110741.1|CK110741 P028B12 Populus petioles cDNA librar... 40 0.084
gb|CN518887.1|CN518887 GQ0104.B3_G13 GQ010 Populus trichoca... 40 0.084
gb|CN523111.1|CN523111 GQ0121.B3_P11 GQ012 Populus trichoca... 40 0.084
gb|CN523297.1|CN523297 GQ015M01.B3_K24 GQ015 Populus tricho... 40 0.084
gb|CV228648.1|CV228648 WS01910.B21_M22 PT-DX-N-A-10 Populus... 40 0.084
gb|CV231948.1|CV231948 WS0196.B21_A16 PT-DX-N-A-10 Populus ... 40 0.084
gb|CV232592.1|CV232592 WS0198.B21_B09 PT-DX-N-A-10 Populus ... 40 0.084
gb|CV240013.1|CV240013 WS0234.B21_C09 PT-MB-A-13 Populus tr... 40 0.084
gb|CV246306.1|CV246306 WS0111.B21_P12 PT-P-FL-A-2 Populus t... 40 0.084
gb|CV247955.1|CV247955 WS01119.B21_O11 PT-P-FL-A-2 Populus ... 40 0.084
gb|CV249199.1|CV249199 WS01123.B21_F12 PT-P-FL-A-2 Populus ... 40 0.084
gb|CV253056.1|CV253056 PX0019.B21_A16 PT-X-FL-A-1 Populus t... 40 0.084
gb|CV256194.1|CV256194 WS0243.B21_D02 PTxD-ICC-N-A-14 Popul... 40 0.084
gb|CV262629.1|CV262629 WS0202.B21_B09 PTxN-IB-N-A-11 Populu... 40 0.084
gb|CV265671.1|CV265671 WS02027.B21_O16 PTxN-IB-N-A-11 Popul... 40 0.084
gb|CV267143.1|CV267143 WS02030.B21_P03 PTxN-IB-N-A-11 Popul... 40 0.084
gb|CV274219.1|CV274219 WS0172.B21_J10 PTxD-NR-A-8 Populus t... 40 0.084
gb|CV275006.1|CV275006 WS0175.B21_B01 PTxD-NR-A-8 Populus t... 40 0.084
gb|CV282977.1|CV282977 WS0186.B21_B18 PTxD-IL-N-A-9 Populus... 40 0.084
gb|CX168751.1|CX168751 G04_69-67_14.ab1 leaf inoculated wit... 40 0.084
gb|CX173828.1|CX173828 E03_69-36_09.ab1 leaf inoculated wit... 40 0.084
gb|DT494949.1|DT494949 WS01119.BR_O11 PT-P-FL-A-2 Populus t... 40 0.084
gb|DT496415.1|DT496415 WS01123.BR_F12 PT-P-FL-A-2 Populus t... 40 0.084
gb|DT500609.1|DT500609 PX0019.BR.1_A16 PT-X-FL-A-1 Populus ... 40 0.084
gb|DT509405.1|DT509405 WS02423.BR_K08 PTxD-ICC-N-A-14 Popul... 40 0.084
gb|DT514019.1|DT514019 WS02423.B21_K08 PTxD-ICC-N-A-14 Popu... 40 0.084
gb|DT520433.1|DT520433 WS02447.B21_I15 PTxD-ICC-N-A-14 Popu... 40 0.084
gb|DT523617.1|DT523617 WS02040.B21_C23 PTxN-IB-N-A-11 Popul... 40 0.084
>gb|CA928402.1|CA928402 MTU6TR.P2.C04 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 342
Score = 58.0 bits (29), Expect = 4e-007
Identities = 44/49 (89%)
Strand = Plus / Minus
Query: 114 tctaccaagcaatcagatgcatgtcatcatccaagctttttgttggagg 162
|||| |||||||| |||||||||||||| || || ||||||||||||||
Sbjct: 276 tctatcaagcaatgagatgcatgtcatcttcaaaactttttgttggagg 228
>gb|CA928427.1|CA928427 MTU6TR.P2.E09 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 344
Score = 58.0 bits (29), Expect = 4e-007
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 114 tctaccaagcaatcagatgcatgtcatcatccaagctttttgttggagg 162
|||| |||||||| |||||||||||||| || || ||||||||||||||
Sbjct: 69 tctatcaagcaatgagatgcatgtcatcttcaaaactttttgttggagg 117
>gb|AI165442.1|AI165442 A084P15U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 375
Score = 56.0 bits (28), Expect = 1e-006
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||||||||||||||||
Sbjct: 98 tgcatgtcttcatcaaagctttttgttggagggctt 133
>gb|AI165789.1|AI165789 A091p48u Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 365
Score = 56.0 bits (28), Expect = 1e-006
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||||||||||||||||
Sbjct: 97 tgcatgtcttcatcaaagctttttgttggagggctt 132
>gb|BI128919.1|BI128919 G083P51Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 403
Score = 56.0 bits (28), Expect = 1e-006
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||||||||||||||||
Sbjct: 170 tgcatgtcttcatcaaagctttttgttggagggctt 205
>gb|BU827425.1|BU827425 K002P08P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 289
Score = 56.0 bits (28), Expect = 1e-006
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
||||||||||||||||||||||| |||||||||||
Sbjct: 176 tgcatgtcatcatccaagcttttcattggagggctt 211
>gb|BU833744.1|BU833744 T052A02 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 549
Score = 56.0 bits (28), Expect = 1e-006
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||||||||||||||||
Sbjct: 100 tgcatgtcttcatcaaagctttttgttggagggctt 135
>gb|CK099777.1|CK099777 A084P15.5pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A084P15 5', mRNA sequence
Length = 376
Score = 56.0 bits (28), Expect = 1e-006
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||||||||||||||||
Sbjct: 131 tgcatgtcttcatcaaagctttttgttggagggctt 166
>gb|CA929488.1|CA929488 MTU2CA.P14.E06 Aspen apex cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 513
Score = 52.0 bits (26), Expect = 2e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 129 gatgcatgtcatcatccaagctttttgttggagggctt 166
|||||||||| |||||||||||||| |||||||||||
Sbjct: 490 gatgcatgtcttcatccaagcttttcattggagggctt 453
>gb|BI138489.1|BI138489 F107P68Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 449
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 171 tgcatgtcgtcatccaagcttttcattggagggctt 206
>gb|BU810743.1|BU810743 UL74PG02 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 483
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 189 tgcatgtcttcatcaaagcttttcgttggagggctt 224
>gb|BU813395.1|BU813395 N009H11 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 693
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 207 tgcatgtcttcatcaaagcttttcgttggagggctt 242
>gb|BU817020.1|BU817020 UA11BPH11 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 485
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 190 tgcatgtcttcatcaaagcttttcgttggagggctt 225
>gb|BU824801.1|BU824801 UK100A06 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 584
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 195 tgcatgtcttcatccaagcttttcattggagggctt 230
>gb|BU825687.1|BU825687 UK111TH07 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 582
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 195 tgcatgtcttcatccaagcttttcattggagggctt 230
>gb|BU826604.1|BU826604 UK122TF03 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 593
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 199 tgcatgtcttcatccaagcttttcattggagggctt 234
>gb|BU828809.1|BU828809 K028P94P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 188
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 93 tgcatgtcttcatccaagcttttcattggagggctt 128
>gb|BU828991.1|BU828991 K032P21P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 544
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 165 tgcatgtcttcatccaagcttttcattggagggctt 200
>gb|BU830621.1|BU830621 T010H03 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 489
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 198 tgcatgtcttcatccaagcttttcattggagggctt 233
>gb|BU832801.1|BU832801 T038D06 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 707
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 196 tgcatgtcttcatccaagcttttcattggagggctt 231
>gb|BU834424.1|BU834424 T061A09 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 235
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 190 tgcatgtcttcatccaagcttttcattggagggctt 225
>gb|BU834470.1|BU834470 T061F01 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 384
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 185 tgcatgtcttcatccaagcttttcattggagggctt 220
>gb|BU835269.1|BU835269 T071G06 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 710
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 197 tgcatgtcttcatcaaagcttttcgttggagggctt 232
>gb|BU836310.1|BU836310 T085C08 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 723
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 195 tgcatgtcttcatccaagcttttcattggagggctt 230
>gb|BU836411.1|BU836411 T086C04 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 695
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 205 tgcatgtcttcatccaagcttttcattggagggctt 240
>gb|BU836638.1|BU836638 T089A12 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 657
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 200 tgcatgtcttcatccaagcttttcattggagggctt 235
>gb|BU836911.1|BU836911 T092D08 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 666
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 197 tgcatgtcttcatccaagcttttcattggagggctt 232
>gb|BU836980.1|BU836980 T093C06 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 356
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 199 tgcatgtcttcatccaagcttttcattggagggctt 234
>gb|BU837852.1|BU837852 T106D05 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 693
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 198 tgcatgtcttcatccaagcttttcattggagggctt 233
>gb|BU871870.1|BU871870 Q035E05 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 691
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 200 tgcatgtcttcatcaaagcttttcgttggagggctt 235
>gb|BU876518.1|BU876518 V021G02 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 501
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 175 tgcatgtcgtcatccaagcttttcattggagggctt 210
>gb|BU876936.1|BU876936 V027B11 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 449
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 175 tgcatgtcgtcatccaagcttttcattggagggctt 210
>gb|BU877414.1|BU877414 V033G03 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 640
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 175 tgcatgtcgtcatccaagcttttcattggagggctt 210
>gb|BU887209.1|BU887209 R056C04 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 683
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 177 tgcatgtcttcatcaaagcttttcgttggagggctt 212
>gb|BU888180.1|BU888180 P004G02 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 506
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 203 tgcatgtcttcatcaaagcttttcgttggagggctt 238
>gb|BU888201.1|BU888201 P005A03 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 463
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 203 tgcatgtcttcatccaagcttttcattggagggctt 238
>gb|BU888300.1|BU888300 P006C05 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 438
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 85 tgcatgtcttcatcaaagcttttcgttggagggctt 120
>gb|BU888746.1|BU888746 P012A03 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 393
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 194 tgcatgtcttcatccaagcttttcattggagggctt 229
>gb|BU889151.1|BU889151 P017D02 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 602
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 116 tgcatgtcttcatccaagcttttcattggagggctt 151
>gb|BU889688.1|BU889688 P024D03 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 552
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 217 tgcatgtcttcatcaaagcttttcgttggagggctt 252
>gb|BU891317.1|BU891317 P048F06 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 594
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 190 tgcatgtcttcatcaaagcttttcgttggagggctt 225
>gb|BU892183.1|BU892183 P060E05 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 716
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 197 tgcatgtcttcatccaagcttttcattggagggctt 232
>gb|CA929637.1|CA929637 MTU2CA.P16.E05 Aspen apex cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 620
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 490 tgcatgtcttcatccaagcttttcattggagggctt 455
>gb|CA824338.1|CA824338 R40C10 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 549
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 191 tgcatgtcttcatccaagcttttcattggagggctt 226
>gb|CA824768.1|CA824768 R48B01 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 547
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 247 tgcatgtcgtcatccaagcttttcattggagggctt 282
>gb|CF231976.1|CF231976 PtaJXO0005A4A0402 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 650
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 159 tgcatgtcttcatccaagcttttcattggagggctt 194
>gb|CK108120.1|CK108120 G102P75 Populus tension wood cDNA library Populus tremula x Populus
tremuloides cDNA clone G102P75 5', mRNA sequence
Length = 352
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 197 tgcatgtcttcatccaagcttttcattggagggctt 232
>gb|CK113139.1|CK113139 UR103TD07 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA clone UR103TD07 5', mRNA sequence
Length = 574
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 202 tgcatgtcttcatccaagcttttcattggagggctt 237
>gb|CN522385.1|CN522385 GQ0122.B3_E11 GQ012 Populus trichocarpa x Populus deltoides cDNA
clone GQ0122_E11 5', mRNA sequence
Length = 478
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| |||||||||||||| |||||||||||
Sbjct: 168 tgcatgtcgtcatccaagcttttcattggagggctt 203
>gb|AJ774714.1|AJ774714 AJ774714 Populus euphratica shoot 3-6 months Populus euphratica
cDNA clone P0000300023E02F1, mRNA sequence
Length = 656
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 131 tgcatgtcatcatccaagctttttgttggagggctt 166
|||||||| ||||| |||||||| ||||||||||||
Sbjct: 156 tgcatgtcttcatcaaagcttttcgttggagggctt 191
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 47,673
Number of Sequences: 369679
Number of extensions: 47673
Number of successful extensions: 14109
Number of sequences better than 0.5: 107
Number of HSP's better than 0.5 without gapping: 107
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 13998
Number of HSP's gapped (non-prelim): 111
length of query: 537
length of database: 203,408,664
effective HSP length: 19
effective length of query: 518
effective length of database: 196,384,763
effective search space: 101727307234
effective search space used: 101727307234
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)