BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2437739.2.2
(2231 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CX177511.1|CX177511 E07_45-18_09.ab1 leaf inoculated wit... 42 0.091
gb|CX179573.1|CX179573 E11_45-15_09.ab1 leaf inoculated wit... 42 0.091
gb|CX180774.1|CX180774 F07_45-58_11.ab1 leaf inoculated wit... 42 0.091
gb|CX183460.1|CX183460 D05_45-19_07.ab1 leaf inoculated wit... 42 0.091
gb|CX183733.1|CX183733 G04_45-70_14.ab1 leaf inoculated wit... 42 0.091
gb|CX184923.1|CX184923 A09_45-74_01.ab1 leaf inoculated wit... 42 0.091
gb|CX186282.1|CX186282 B01_45-29_03.ab1 leaf inoculated wit... 42 0.091
gb|DT501754.1|DT501754 WS01314.BR_B07 PTxD-IL-FL-A-4 Populu... 42 0.091
gb|DT504614.1|DT504614 WS01314.B21_B07 PTxD-IL-FL-A-4 Popul... 42 0.091
gb|BU819759.1|BU819759 UA47BPB12 Populus tremula cambium cD... 40 0.36
gb|BU828888.1|BU828888 K030P64P Populus apical shoot cDNA l... 40 0.36
gb|BU830943.1|BU830943 T015B04 Populus apical shoot cDNA li... 40 0.36
gb|BU888197.1|BU888197 P004H11 Populus petioles cDNA librar... 40 0.36
gb|CF228353.1|CF228353 PtaXM0012A2A0202 Poplar cDNA library... 40 0.36
gb|CF230814.1|CF230814 PtaC0013E4E0410 Poplar cDNA library ... 40 0.36
gb|CF234877.1|CF234877 PtaJXT0016C11C1105 Poplar cDNA libra... 40 0.36
gb|CV233363.1|CV233363 WS01210.B21_C12 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV233542.1|CV233542 WS01211.B21_G12 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV233754.1|CV233754 WS01212.B21_D23 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV233918.1|CV233918 WS01212.B21_O06 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV234087.1|CV234087 WS01213.B21_J01 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV234300.1|CV234300 WS01214.B21_G17 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV234508.1|CV234508 WS01215.B21.1_C19 PT-GT-FL-A-3 Popul... 40 0.36
gb|CV235043.1|CV235043 WS01217.B21_H10 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV235341.1|CV235341 WS01218.B21_M04 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV235405.1|CV235405 WS01218.B21_P22 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV235489.1|CV235489 WS0122.B21_F11 PT-GT-FL-A-3 Populus ... 40 0.36
gb|CV236156.1|CV236156 WS01223.B21_A21 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV236560.1|CV236560 WS01224.B21.1_J01 PT-GT-FL-A-3 Popul... 40 0.36
gb|CV236983.1|CV236983 WS01226.B21.1_D02 PT-GT-FL-A-3 Popul... 40 0.36
gb|CV237129.1|CV237129 WS01226.B21_B12 PT-GT-FL-A-3 Populus... 40 0.36
gb|CV237593.1|CV237593 WS0123.B21_G03 PT-GT-FL-A-3 Populus ... 40 0.36
gb|CV238817.1|CV238817 WS0128.B21.1_C23 PT-GT-FL-A-3 Populu... 40 0.36
gb|CV238894.1|CV238894 WS0128.B21.1_I18 PT-GT-FL-A-3 Populu... 40 0.36
gb|CV246167.1|CV246167 WS0111.B21_I07 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV246379.1|CV246379 WS01110.B21_E02 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV246444.1|CV246444 WS01110.B21_I06 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV247926.1|CV247926 WS01119.B21_M24 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV247989.1|CV247989 WS0112.B21_A07 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV248045.1|CV248045 WS0112.B21_D17 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV248166.1|CV248166 WS0112.B21_K13 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV248395.1|CV248395 WS01120.B21_J06 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV248591.1|CV248591 WS01121.B21_E16 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV248977.1|CV248977 WS01122.B21_J21 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV249202.1|CV249202 WS01123.B21_F15 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV249555.1|CV249555 WS01124.B21_J02 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV249668.1|CV249668 WS01124.B21_O23 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV249683.1|CV249683 WS01124.B21_P18 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV249846.1|CV249846 WS01125.B21_H23 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV249911.1|CV249911 WS01125.B21_L05 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV250146.1|CV250146 WS01126.B21_I17 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV250219.1|CV250219 WS01126.B21_N08 PT-P-FL-A-2 Populus ... 40 0.36
gb|CV250263.1|CV250263 WS0113.B21_A02 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV250379.1|CV250379 WS0113.B21_G01 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV250440.1|CV250440 WS0113.B21_J03 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV250495.1|CV250495 WS0113.B21_M01 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV250566.1|CV250566 WS0113.B21_P21 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV250582.1|CV250582 WS0114.B21_A23 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV251108.1|CV251108 WS0115.B21_N19 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV251196.1|CV251196 WS0116.B21_C13 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV251283.1|CV251283 WS0116.B21_H12 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV251659.1|CV251659 WS0117.B21_N18 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV251668.1|CV251668 WS0117.B21_O09 PT-P-FL-A-2 Populus t... 40 0.36
gb|CV251735.1|CV251735 WS0118.B21.1_G21 PT-P-FL-A-2 Populus... 40 0.36
gb|CV251758.1|CV251758 WS0118.B21.1_M11 PT-P-FL-A-2 Populus... 40 0.36
gb|CV252872.1|CV252872 PX0019.B21.1_E18 PT-X-FL-A-1 Populus... 40 0.36
gb|CV254026.1|CV254026 WS0223.B21_M08 PTxD-ICC-A-12 Populus... 40 0.36
gb|CV256913.1|CV256913 WS0245.B21_C09 PTxD-ICC-N-A-14 Popul... 40 0.36
gb|CV259819.1|CV259819 WS02012.B21_F21 PTxN-IB-N-A-11 Popul... 40 0.36
gb|CV280078.1|CV280078 WS0134.B21_L04 PTxD-IL-FL-A-4 Populu... 40 0.36
gb|CV280936.1|CV280936 WS0138.B21_E20 PTxD-IL-FL-A-4 Populu... 40 0.36
gb|DT470673.1|DT470673 WS01210.BR_C12 PT-GT-FL-A-3 Populus ... 40 0.36
gb|DT471868.1|DT471868 WS0122.BR_F11 PT-GT-FL-A-3 Populus t... 40 0.36
gb|DT472374.1|DT472374 WS01226.BR.1_D02 PT-GT-FL-A-3 Populu... 40 0.36
gb|DT472499.1|DT472499 WS01226.BR_B12 PT-GT-FL-A-3 Populus ... 40 0.36
gb|DT473268.1|DT473268 WS01229.BR_B22 PT-GT-FL-A-3 Populus ... 40 0.36
gb|DT473393.1|DT473393 WS01229.BR_I09 PT-GT-FL-A-3 Populus ... 40 0.36
gb|DT473673.1|DT473673 WS0123.BR_G03 PT-GT-FL-A-3 Populus t... 40 0.36
gb|DT475541.1|DT475541 WS0127.BR_G24 PT-GT-FL-A-3 Populus t... 40 0.36
gb|DT475778.1|DT475778 WS0128.BR_C23 PT-GT-FL-A-3 Populus t... 40 0.36
gb|DT476311.1|DT476311 WS01229.B21_B22 PT-GT-FL-A-3 Populus... 40 0.36
gb|DT484341.1|DT484341 WS02525.B21_C07 PT-MB-N-A-15 Populus... 40 0.36
gb|DT493488.1|DT493488 WS0111.BR_I07 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT494893.1|DT494893 WS01119.BR_L23 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT494917.1|DT494917 WS01119.BR_M24 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT494986.1|DT494986 WS0112.BR_A07 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT495053.1|DT495053 WS0112.BR_D17 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT495189.1|DT495189 WS0112.BR_K13 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT495412.1|DT495412 WS01120.BR_G07 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT495474.1|DT495474 WS01120.BR_J06 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT495718.1|DT495718 WS01121.BR_E16 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT496285.1|DT496285 WS01122.BR_P14 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT496418.1|DT496418 WS01123.BR_F15 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT496473.1|DT496473 WS01123.BR_I09 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT496807.1|DT496807 WS01124.BR_J02 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT496930.1|DT496930 WS01124.BR_P18 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT497104.1|DT497104 WS01125.BR_H23 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT497460.1|DT497460 WS01126.BR_I17 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT497561.1|DT497561 WS01126.BR_N08 PT-P-FL-A-2 Populus t... 40 0.36
gb|DT497621.1|DT497621 WS0113.BR_A02 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT497750.1|DT497750 WS0113.BR_G01 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT497822.1|DT497822 WS0113.BR_J03 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT497886.1|DT497886 WS0113.BR_M01 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT497967.1|DT497967 WS0113.BR_P21 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT498617.1|DT498617 WS0115.BR_N19 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT498713.1|DT498713 WS0116.BR_C13 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT498826.1|DT498826 WS0116.BR_H12 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT499285.1|DT499285 WS0117.BR_N18 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT499297.1|DT499297 WS0117.BR_O09 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT499480.1|DT499480 WS0118.BR_G21 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT499604.1|DT499604 WS0118.BR_M11 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT499899.1|DT499899 WS9991.BR_K16 PT-P-FL-A-2 Populus tr... 40 0.36
gb|DT500641.1|DT500641 PX0019.BR.1_E18 PT-X-FL-A-1 Populus ... 40 0.36
gb|DT500737.1|DT500737 PX0019.BR_A01 PT-X-FL-A-1 Populus tr... 40 0.36
gb|DT502431.1|DT502431 WS0132.BR_P05 PTxD-IL-FL-A-4 Populus... 40 0.36
gb|DT502910.1|DT502910 WS0134.BR_L04 PTxD-IL-FL-A-4 Populus... 40 0.36
gb|DT503915.1|DT503915 WS0138.BR_E20 PTxD-IL-FL-A-4 Populus... 40 0.36
gb|DT504323.1|DT504323 WS01312.B21_O13 PTxD-IL-FL-A-4 Popul... 40 0.36
>gb|CX177511.1|CX177511 E07_45-18_09.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 707
Score = 42.1 bits (21), Expect = 0.091
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgga 1552
||||||||||||||||||| |||||
Sbjct: 382 tggacgccgtgaaggcggcggtgga 406
>gb|CX179573.1|CX179573 E11_45-15_09.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 639
Score = 42.1 bits (21), Expect = 0.091
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgga 1552
||||||||||||||||||| |||||
Sbjct: 379 tggacgccgtgaaggcggcggtgga 403
>gb|CX180774.1|CX180774 F07_45-58_11.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 394
Score = 42.1 bits (21), Expect = 0.091
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgga 1552
||||||||||||||||||| |||||
Sbjct: 347 tggacgccgtgaaggcggcggtgga 371
>gb|CX183460.1|CX183460 D05_45-19_07.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 707
Score = 42.1 bits (21), Expect = 0.091
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgga 1552
||||||||||||||||||| |||||
Sbjct: 403 tggacgccgtgaaggcggcggtgga 427
>gb|CX183733.1|CX183733 G04_45-70_14.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 693
Score = 42.1 bits (21), Expect = 0.091
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgga 1552
||||||||||||||||||| |||||
Sbjct: 406 tggacgccgtgaaggcggcggtgga 430
>gb|CX184923.1|CX184923 A09_45-74_01.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 632
Score = 42.1 bits (21), Expect = 0.091
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgga 1552
||||||||||||||||||| |||||
Sbjct: 356 tggacgccgtgaaggcggcggtgga 380
>gb|CX186282.1|CX186282 B01_45-29_03.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 548
Score = 42.1 bits (21), Expect = 0.091
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgga 1552
||||||||||||||||||| |||||
Sbjct: 390 tggacgccgtgaaggcggcggtgga 414
>gb|DT501754.1|DT501754 WS01314.BR_B07 PTxD-IL-FL-A-4 Populus trichocarpa x Populus deltoides
cDNA clone WS01314_B07 5', mRNA sequence
Length = 845
Score = 42.1 bits (21), Expect = 0.091
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgga 1552
||||||||||||||||||| |||||
Sbjct: 392 tggacgccgtgaaggcggcggtgga 416
>gb|DT504614.1|DT504614 WS01314.B21_B07 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS01314_B07 3', mRNA sequence
Length = 898
Score = 42.1 bits (21), Expect = 0.091
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgga 1552
||||||||||||||||||| |||||
Sbjct: 527 tggacgccgtgaaggcggcggtgga 503
>gb|BU819759.1|BU819759 UA47BPB12 Populus tremula cambium cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 590
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 248 tggacgccgtgaaggcggcggtgg 271
>gb|BU828888.1|BU828888 K030P64P Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 600
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 371 tggacgccgtgaaggcggcggtgg 394
>gb|BU830943.1|BU830943 T015B04 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 559
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 365 tggacgccgtgaaggcggcggtgg 388
>gb|BU888197.1|BU888197 P004H11 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 421
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 393 tggacgccgtgaaggcggcggtgg 416
>gb|CF228353.1|CF228353 PtaXM0012A2A0202 Poplar cDNA library from mature xylem Populus alba x
Populus tremula cDNA 5', mRNA sequence
Length = 486
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 390 tggacgccgtgaaggcggcggtgg 413
>gb|CF230814.1|CF230814 PtaC0013E4E0410 Poplar cDNA library from cambial zone Populus alba x
Populus tremula cDNA 5', mRNA sequence
Length = 758
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 379 tggacgccgtgaaggcggcggtgg 402
>gb|CF234877.1|CF234877 PtaJXT0016C11C1105 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 546
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 398 tggacgccgtgaaggcggcggtgg 421
>gb|CV233363.1|CV233363 WS01210.B21_C12 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01210_C12 3', mRNA sequence
Length = 480
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV233542.1|CV233542 WS01211.B21_G12 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01211_G12 3', mRNA sequence
Length = 755
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV233754.1|CV233754 WS01212.B21_D23 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01212_D23 3', mRNA sequence
Length = 815
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV233918.1|CV233918 WS01212.B21_O06 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01212_O06 3', mRNA sequence
Length = 844
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 417 tggacgccgtgaaggcggcggtgg 394
>gb|CV234087.1|CV234087 WS01213.B21_J01 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01213_J01 3', mRNA sequence
Length = 727
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV234300.1|CV234300 WS01214.B21_G17 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01214_G17 3', mRNA sequence
Length = 723
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV234508.1|CV234508 WS01215.B21.1_C19 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01215_C19 3', mRNA sequence
Length = 756
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 341 tggacgccgtgaaggcggcggtgg 318
>gb|CV235043.1|CV235043 WS01217.B21_H10 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01217_H10 3', mRNA sequence
Length = 727
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV235341.1|CV235341 WS01218.B21_M04 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01218_M04 3', mRNA sequence
Length = 634
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV235405.1|CV235405 WS01218.B21_P22 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01218_P22 3', mRNA sequence
Length = 635
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV235489.1|CV235489 WS0122.B21_F11 PT-GT-FL-A-3 Populus trichocarpa cDNA clone WS0122_F11
3', mRNA sequence
Length = 546
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV236156.1|CV236156 WS01223.B21_A21 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01223_A21 3', mRNA sequence
Length = 808
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV236560.1|CV236560 WS01224.B21.1_J01 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01224_J01 3', mRNA sequence
Length = 817
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV236983.1|CV236983 WS01226.B21.1_D02 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01226_D02 3', mRNA sequence
Length = 810
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 388 tggacgccgtgaaggcggcggtgg 365
>gb|CV237129.1|CV237129 WS01226.B21_B12 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01226_B12 3', mRNA sequence
Length = 811
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV237593.1|CV237593 WS0123.B21_G03 PT-GT-FL-A-3 Populus trichocarpa cDNA clone WS0123_G03
3', mRNA sequence
Length = 592
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 396 tggacgccgtgaaggcggcggtgg 373
>gb|CV238817.1|CV238817 WS0128.B21.1_C23 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0128_C23 3', mRNA sequence
Length = 653
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV238894.1|CV238894 WS0128.B21.1_I18 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0128_I18 3', mRNA sequence
Length = 727
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV246167.1|CV246167 WS0111.B21_I07 PT-P-FL-A-2 Populus trichocarpa cDNA clone WS0111_I07
3', mRNA sequence
Length = 706
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV246379.1|CV246379 WS01110.B21_E02 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01110_E02 3', mRNA sequence
Length = 734
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV246444.1|CV246444 WS01110.B21_I06 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01110_I06 3', mRNA sequence
Length = 727
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV247926.1|CV247926 WS01119.B21_M24 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01119_M24 3', mRNA sequence
Length = 705
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV247989.1|CV247989 WS0112.B21_A07 PT-P-FL-A-2 Populus trichocarpa cDNA clone WS0112_A07
3', mRNA sequence
Length = 617
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 344 tggacgccgtgaaggcggcggtgg 321
>gb|CV248045.1|CV248045 WS0112.B21_D17 PT-P-FL-A-2 Populus trichocarpa cDNA clone WS0112_D17
3', mRNA sequence
Length = 703
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV248166.1|CV248166 WS0112.B21_K13 PT-P-FL-A-2 Populus trichocarpa cDNA clone WS0112_K13
3', mRNA sequence
Length = 646
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV248395.1|CV248395 WS01120.B21_J06 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01120_J06 3', mRNA sequence
Length = 727
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV248591.1|CV248591 WS01121.B21_E16 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01121_E16 3', mRNA sequence
Length = 604
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 345 tggacgccgtgaaggcggcggtgg 322
>gb|CV248977.1|CV248977 WS01122.B21_J21 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01122_J21 3', mRNA sequence
Length = 710
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 390 tggacgccgtgaaggcggcggtgg 367
>gb|CV249202.1|CV249202 WS01123.B21_F15 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01123_F15 3', mRNA sequence
Length = 724
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV249555.1|CV249555 WS01124.B21_J02 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01124_J02 3', mRNA sequence
Length = 698
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV249668.1|CV249668 WS01124.B21_O23 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01124_O23 3', mRNA sequence
Length = 636
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 388 tggacgccgtgaaggcggcggtgg 365
>gb|CV249683.1|CV249683 WS01124.B21_P18 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01124_P18 3', mRNA sequence
Length = 727
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV249846.1|CV249846 WS01125.B21_H23 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01125_H23 3', mRNA sequence
Length = 727
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 387 tggacgccgtgaaggcggcggtgg 364
>gb|CV249911.1|CV249911 WS01125.B21_L05 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01125_L05 3', mRNA sequence
Length = 743
Score = 40.1 bits (20), Expect = 0.36
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1528 tggacgccgtgaaggcggccgtgg 1551
||||||||||||||||||| ||||
Sbjct: 388 tggacgccgtgaaggcggcggtgg 365
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 165,557
Number of Sequences: 369679
Number of extensions: 165557
Number of successful extensions: 48757
Number of sequences better than 0.5: 118
Number of HSP's better than 0.5 without gapping: 118
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48633
Number of HSP's gapped (non-prelim): 124
length of query: 2231
length of database: 203,408,664
effective HSP length: 20
effective length of query: 2211
effective length of database: 196,015,084
effective search space: 433389350724
effective search space used: 433389350724
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)