BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419405.2.3
(1600 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF228012.1|CF228012 PtaXM0007F1F0111 Poplar cDNA library... 44 0.016
gb|CK096855.1|CK096855 UB30CPB12.3pR Populus active cambium... 44 0.016
gb|BP934447.1|BP934447 BP934447 full-length enriched poplar... 44 0.016
gb|BI123484.1|BI123484 I024P12P Populus leaf cDNA library P... 42 0.065
gb|CK094333.1|CK094333 I024P12.3pR Populus senescing leaves... 42 0.065
gb|CK094348.1|CK094348 I024P69.3pR Populus senescing leaves... 42 0.065
gb|CK104293.1|CK104293 I024P12.5pR Populus senescing leaves... 42 0.065
gb|BU820472.1|BU820472 UB10CPE12 Populus tremula cambium cD... 40 0.26
gb|BU888893.1|BU888893 P014A02 Populus petioles cDNA librar... 40 0.26
gb|CK110877.1|CK110877 P042E10 Populus petioles cDNA librar... 40 0.26
gb|AJ776862.1|AJ776862 AJ776862 Populus euphratica root 3-6... 40 0.26
gb|CV227041.1|CV227041 WS0166.B21_A10 PT-DX-A-7 Populus tri... 40 0.26
gb|CV233689.1|CV233689 WS01212.B21_A05 PT-GT-FL-A-3 Populus... 40 0.26
gb|CV236248.1|CV236248 WS01223.B21_G18 PT-GT-FL-A-3 Populus... 40 0.26
gb|CV243890.1|CV243890 WS0253.B21_C11 PT-MB-N-A-15 Populus ... 40 0.26
gb|CV250212.1|CV250212 WS01126.B21_N01 PT-P-FL-A-2 Populus ... 40 0.26
gb|CV253794.1|CV253794 WS0223.B21_A11 PTxD-ICC-A-12 Populus... 40 0.26
gb|CV270428.1|CV270428 WS0151.B21_P14 PTxN-IB-A-6 Populus t... 40 0.26
gb|CV279429.1|CV279429 WS0131.B21_L15 PTxD-IL-FL-A-4 Populu... 40 0.26
gb|CV280760.1|CV280760 WS0137.B21_J10 PTxD-IL-FL-A-4 Populu... 40 0.26
gb|CX182335.1|CX182335 D01_45-67_07.ab1 leaf inoculated wit... 40 0.26
gb|CX182794.1|CX182794 D09_45-123_07.ab1 leaf inoculated wi... 40 0.26
gb|DT471061.1|DT471061 WS01212.BR_A05 PT-GT-FL-A-3 Populus ... 40 0.26
gb|DT473691.1|DT473691 WS0123.BR_H03 PT-GT-FL-A-3 Populus t... 40 0.26
gb|DT497554.1|DT497554 WS01126.BR_N01 PT-P-FL-A-2 Populus t... 40 0.26
gb|DT501160.1|DT501160 WS0131.BR_L15 PTxD-IL-FL-A-4 Populus... 40 0.26
gb|DT503720.1|DT503720 WS0137.BR_J10 PTxD-IL-FL-A-4 Populus... 40 0.26
gb|DT506033.1|DT506033 WS01812.C21_I07 PTxD-IL-N-A-9 Populu... 40 0.26
gb|DT518395.1|DT518395 WS02438.B21_A10 PTxD-ICC-N-A-14 Popu... 40 0.26
gb|DT524074.1|DT524074 WS02041.C21.1_H14 PTxN-IB-N-A-11 Pop... 40 0.26
gb|DV464618.1|DV464618 MTUNUL1.P29.G04 NUL Populus fremonti... 40 0.26
>gb|CF228012.1|CF228012 PtaXM0007F1F0111 Poplar cDNA library from mature xylem Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 621
Score = 44.1 bits (22), Expect = 0.016
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 199 gaatgaagatgatgatgatgat 220
||||||||||||||||||||||
Sbjct: 113 gaatgaagatgatgatgatgat 134
>gb|CK096855.1|CK096855 UB30CPB12.3pR Populus active cambium cDNA library Populus tremula
cDNA clone UB30CPB12 3', mRNA sequence
Length = 891
Score = 44.1 bits (22), Expect = 0.016
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 199 gaatgaagatgatgatgatgat 220
||||||||||||||||||||||
Sbjct: 509 gaatgaagatgatgatgatgat 488
>gb|BP934447.1|BP934447 BP934447 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-065_H15.r 3', mRNA sequence
Length = 640
Score = 44.1 bits (22), Expect = 0.016
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 199 gaatgaagatgatgatgatgat 220
||||||||||||||||||||||
Sbjct: 537 gaatgaagatgatgatgatgat 516
>gb|BI123484.1|BI123484 I024P12P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 322
Score = 42.1 bits (21), Expect = 0.065
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 200 aatgaagatgatgatgatgataaat 224
||||| |||||||||||||||||||
Sbjct: 164 aatgatgatgatgatgatgataaat 140
>gb|CK094333.1|CK094333 I024P12.3pR Populus senescing leaves cDNA library Populus tremula
cDNA clone I024P12 3', mRNA sequence
Length = 430
Score = 42.1 bits (21), Expect = 0.065
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 200 aatgaagatgatgatgatgataaat 224
||||| |||||||||||||||||||
Sbjct: 237 aatgatgatgatgatgatgataaat 261
>gb|CK094348.1|CK094348 I024P69.3pR Populus senescing leaves cDNA library Populus tremula
cDNA clone I024P69 3', mRNA sequence
Length = 429
Score = 42.1 bits (21), Expect = 0.065
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 200 aatgaagatgatgatgatgataaat 224
||||| |||||||||||||||||||
Sbjct: 236 aatgatgatgatgatgatgataaat 260
>gb|CK104293.1|CK104293 I024P12.5pR Populus senescing leaves cDNA library Populus tremula
cDNA clone I024P12 5', mRNA sequence
Length = 214
Score = 42.1 bits (21), Expect = 0.065
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 200 aatgaagatgatgatgatgataaat 224
||||| |||||||||||||||||||
Sbjct: 174 aatgatgatgatgatgatgataaat 150
>gb|BU820472.1|BU820472 UB10CPE12 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 445
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 202 tgaagatgatgatgatgata 221
||||||||||||||||||||
Sbjct: 106 tgaagatgatgatgatgata 125
>gb|BU888893.1|BU888893 P014A02 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 629
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 161 atgaagatgatgatgatgat 142
>gb|CK110877.1|CK110877 P042E10 Populus petioles cDNA library Populus tremula cDNA clone
P042E10 5', mRNA sequence
Length = 293
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 202 tgaagatgatgatgatgata 221
||||||||||||||||||||
Sbjct: 191 tgaagatgatgatgatgata 210
>gb|AJ776862.1|AJ776862 AJ776862 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400019F01F1, mRNA sequence
Length = 409
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 39 atgaagatgatgatgatgat 20
>gb|CV227041.1|CV227041 WS0166.B21_A10 PT-DX-A-7 Populus trichocarpa cDNA clone WS0166_A10
3', mRNA sequence
Length = 477
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 343 atgaagatgatgatgatgat 324
>gb|CV233689.1|CV233689 WS01212.B21_A05 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01212_A05 3', mRNA sequence
Length = 915
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 855 atgaagatgatgatgatgat 836
>gb|CV236248.1|CV236248 WS01223.B21_G18 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01223_G18 3', mRNA sequence
Length = 895
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 855 atgaagatgatgatgatgat 836
>gb|CV243890.1|CV243890 WS0253.B21_C11 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS0253_C11 3', mRNA sequence
Length = 719
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 314 atgaagatgatgatgatgat 295
>gb|CV250212.1|CV250212 WS01126.B21_N01 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01126_N01 3', mRNA sequence
Length = 490
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 202 tgaagatgatgatgatgata 221
||||||||||||||||||||
Sbjct: 246 tgaagatgatgatgatgata 227
>gb|CV253794.1|CV253794 WS0223.B21_A11 PTxD-ICC-A-12 Populus trichocarpa x Populus
deltoides cDNA clone WS0223_A11 3', mRNA sequence
Length = 544
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 348 atgaagatgatgatgatgat 329
>gb|CV270428.1|CV270428 WS0151.B21_P14 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0151_P14 3', mRNA sequence
Length = 877
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 346 atgaagatgatgatgatgat 327
>gb|CV279429.1|CV279429 WS0131.B21_L15 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0131_L15 3', mRNA sequence
Length = 355
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 147 atgaagatgatgatgatgat 166
>gb|CV280760.1|CV280760 WS0137.B21_J10 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0137_J10 3', mRNA sequence
Length = 355
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 147 atgaagatgatgatgatgat 166
>gb|CX182335.1|CX182335 D01_45-67_07.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 635
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 306 atgaagatgatgatgatgat 325
>gb|CX182794.1|CX182794 D09_45-123_07.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 461
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 117 atgaagatgatgatgatgat 136
>gb|DT471061.1|DT471061 WS01212.BR_A05 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01212_A05 5', mRNA sequence
Length = 611
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 296 atgaagatgatgatgatgat 315
>gb|DT473691.1|DT473691 WS0123.BR_H03 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0123_H03 5', mRNA sequence
Length = 606
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 296 atgaagatgatgatgatgat 315
>gb|DT497554.1|DT497554 WS01126.BR_N01 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01126_N01 5', mRNA sequence
Length = 457
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 202 tgaagatgatgatgatgata 221
||||||||||||||||||||
Sbjct: 212 tgaagatgatgatgatgata 231
>gb|DT501160.1|DT501160 WS0131.BR_L15 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0131_L15 5', mRNA sequence
Length = 329
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 183 atgaagatgatgatgatgat 164
>gb|DT503720.1|DT503720 WS0137.BR_J10 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0137_J10 5', mRNA sequence
Length = 323
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 177 atgaagatgatgatgatgat 158
>gb|DT506033.1|DT506033 WS01812.C21_I07 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS01812_I07 3', mRNA sequence
Length = 835
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 343 atgaagatgatgatgatgat 324
>gb|DT518395.1|DT518395 WS02438.B21_A10 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02438_A10 3', mRNA sequence
Length = 301
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 149 atgaagatgatgatgatgat 168
>gb|DT524074.1|DT524074 WS02041.C21.1_H14 PTxN-IB-N-A-11 Populus trichocarpa x Populus
nigra cDNA clone WS02041_H14 3', mRNA sequence
Length = 522
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 343 atgaagatgatgatgatgat 324
>gb|DV464618.1|DV464618 MTUNUL1.P29.G04 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 763
Score = 40.1 bits (20), Expect = 0.26
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 201 atgaagatgatgatgatgat 220
||||||||||||||||||||
Sbjct: 269 atgaagatgatgatgatgat 288
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 132,956
Number of Sequences: 369679
Number of extensions: 132956
Number of successful extensions: 38611
Number of sequences better than 0.5: 31
Number of HSP's better than 0.5 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38445
Number of HSP's gapped (non-prelim): 109
length of query: 1600
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1581
effective length of database: 196,384,763
effective search space: 310484310303
effective search space used: 310484310303
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)