BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2276425.2.1
(753 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AI161661.1|AI161661 A004P72U Hybrid aspen plasmid librar... 76 2e-012
gb|CA926079.1|CA926079 MTU7TL.P9.H01 Aspen leaf cDNA Librar... 76 2e-012
gb|CX656670.1|CX656670 PO02021H09 Poplar SC cDNA library Po... 68 5e-010
gb|CN549763.1|CN549763 GQ0242.B3_I03 GQ024 Populus trichoca... 42 0.030
gb|CA822305.1|CA822305 R06D03 two-month-old roots from clon... 38 0.47
>gb|AI161661.1|AI161661 A004P72U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 598
Score = 75.8 bits (38), Expect = 2e-012
Identities = 92/110 (83%)
Strand = Plus / Plus
Query: 80 tgggggatcttggtcgacaggtacgaggagatgcttgagaattacaagccagggctcggc 139
|||||||||||||| || || |||||||| ||| |||||||||| | ||||| || |||
Sbjct: 55 tgggggatcttggttgatagatacgaggaaatgattgagaattatcacccaggtctgggc 114
Query: 140 gatcaccggtggccactcgtcacacactttgtcgggtgcaagccgtgtgg 189
||||| || ||||| || ||||| |||||||| |||||||| || |||||
Sbjct: 115 gatcatcgttggccgcttgtcactcactttgtggggtgcaaaccttgtgg 164
Score = 42.1 bits (21), Expect = 0.030
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 353 aaggatgagcttgggttgcttcatccagcattcaaggctgt 393
|||||||||||||| |||||||| || ||||| || |||||
Sbjct: 328 aaggatgagcttggcttgcttcaccctgcatttaaagctgt 368
>gb|CA926079.1|CA926079 MTU7TL.P9.H01 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 666
Score = 75.8 bits (38), Expect = 2e-012
Identities = 245/314 (78%)
Strand = Plus / Minus
Query: 80 tgggggatcttggtcgacaggtacgaggagatgcttgagaattacaagccagggctcggc 139
|||||||| ||||| || ||||| ||||| ||| |||||||||| | ||||| || ||
Sbjct: 421 tgggggattttggttgataggtatgaggaaatgattgagaattatcacccaggccttggt 362
Query: 140 gatcaccggtggccactcgtcacacactttgtcgggtgcaagccgtgtggcaaatttgga 199
||||| || ||||| || || || |||||||| ||||||||||| ||||| || || |||
Sbjct: 361 gatcatcgttggccgcttgttactcactttgtggggtgcaagccttgtgggaagttcgga 302
Query: 200 gactaccctgtcgagcgatgcctcaagaatatggaccgtgcattcaattttggggataac 259
|| || | || ||| | || | ||| | ||||| || ||||| ||||||||||||||
Sbjct: 301 gattattcagtggagaggtgtttgaagcagatggatcgcgcatttaattttggggataat 242
Query: 260 cagatcttgcagatgtatgggttcacacacaagtcactagcaagcaggagagtgaagagg 319
|| || |||||||| ||||| || || || || || || || || ||||||| |||||
Sbjct: 241 caaattttgcagatttatggatttactcataaatcgctggctagtcggagagttaagaga 182
Query: 320 atcaggaacgagaccagcaacccacttgagacaaaggatgagcttgggttgcttcatcca 379
| || || ||||| |||| |||||||| | |||||||||||||| |||||||| ||
Sbjct: 181 gtgagaaatgagacaggcaatccacttgaagcgaaggatgagcttggcttgcttcaccct 122
Query: 380 gcattcaaggctgt 393
||||| || |||||
Sbjct: 121 gcatttaaagctgt 108
>gb|CX656670.1|CX656670 PO02021H09 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO02021H09 5', mRNA sequence
Length = 630
Score = 67.9 bits (34), Expect = 5e-010
Identities = 244/314 (77%)
Strand = Plus / Plus
Query: 80 tgggggatcttggtcgacaggtacgaggagatgcttgagaattacaagccagggctcggc 139
|||||||| ||||| || ||||| ||||| ||| |||||||||| | ||||| || ||
Sbjct: 204 tgggggattttggttgataggtatgaggaaatgattgagaattatcacccaggtcttggt 263
Query: 140 gatcaccggtggccactcgtcacacactttgtcgggtgcaagccgtgtggcaaatttgga 199
||||| || |||| || || || |||||||| ||||||||||| ||||| || || |||
Sbjct: 264 gatcatcgtcggccgcttgttactcactttgtggggtgcaagccttgtgggaagttcgga 323
Query: 200 gactaccctgtcgagcgatgcctcaagaatatggaccgtgcattcaattttggggataac 259
|| || | || ||| | || | ||| | ||||| || ||||| ||||||||||||||
Sbjct: 324 gattattcagtggagaggtgtttgaagcagatggatcgcgcatttaattttggggataat 383
Query: 260 cagatcttgcagatgtatgggttcacacacaagtcactagcaagcaggagagtgaagagg 319
|| || |||||||| ||||| || || || || || || || || ||||||| |||||
Sbjct: 384 caaatattgcagatttatggatttactcataaatcgctggctagtcggagagttaagaga 443
Query: 320 atcaggaacgagaccagcaacccacttgagacaaaggatgagcttgggttgcttcatcca 379
| || || ||||| |||| |||||||| | |||||||||||||| |||||||| ||
Sbjct: 444 gtgagaaatgagacaggcaatccacttgaagcgaaggatgagcttggcttgcttcaccct 503
Query: 380 gcattcaaggctgt 393
||||| || |||||
Sbjct: 504 gcatttaaagctgt 517
>gb|CN549763.1|CN549763 GQ0242.B3_I03 GQ024 Populus trichocarpa x Populus deltoides cDNA
clone GQ0242_I03 5', mRNA sequence
Length = 504
Score = 42.1 bits (21), Expect = 0.030
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 353 aaggatgagcttgggttgcttcatccagcattcaaggctgt 393
|||||||||||||| |||||||| || ||||| || |||||
Sbjct: 266 aaggatgagcttggcttgcttcaccctgcatttaaagctgt 306
>gb|CA822305.1|CA822305 R06D03 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 302
Score = 38.2 bits (19), Expect = 0.47
Identities = 88/110 (80%), Gaps = 1/110 (0%)
Strand = Plus / Plus
Query: 80 tgggggatcttggtcgacaggtacgaggagatgcttgagaattacaagccagggctcggc 139
|||||||||||||| || || || ||||| ||| |||||||| | ||||| || ||
Sbjct: 181 tgggggatcttggttgatagatatgaggaaatgattgagaatna-tccccaggtctgggt 239
Query: 140 gatcaccggtggccactcgtcacacactttgtcgggtgcaagccgtgtgg 189
||||| || ||||| || ||||| |||||||| |||||||| || |||||
Sbjct: 240 gatcatcgttggccgcttgtcactcactttgtggggtgcaaaccttgtgg 289
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 94,849
Number of Sequences: 369679
Number of extensions: 94849
Number of successful extensions: 27182
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27167
Number of HSP's gapped (non-prelim): 15
length of query: 753
length of database: 203,408,664
effective HSP length: 19
effective length of query: 734
effective length of database: 196,384,763
effective search space: 144146416042
effective search space used: 144146416042
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)