BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2192593.2.1
(800 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU813476.1|BU813476 N010H08 Populus bark cDNA library Po... 66 2e-009
gb|CA926209.1|CA926209 MTU6CR.P11.C07 Aspen root cDNA Libra... 66 2e-009
gb|CB240336.1|CB240336 PopSC00315 Poplar SC cDNA library Po... 66 2e-009
gb|CN524579.1|CN524579 GQ015M13.T3_C09 GQ015 Populus tricho... 66 2e-009
gb|AJ774952.1|AJ774952 AJ774952 Populus euphratica shoot 3-... 66 2e-009
gb|CV265001.1|CV265001 WS02026.B21_B01 PTxN-IB-N-A-11 Popul... 66 2e-009
gb|CV276058.1|CV276058 WS0178.B21.1_H22 PTxD-NR-A-8 Populus... 66 2e-009
gb|DN485521.1|DN485521 N010H08.3pR Populus bark cDNA librar... 66 2e-009
gb|DN495006.1|DN495006 N010H08.5pR Populus bark cDNA librar... 66 2e-009
gb|DT523819.1|DT523819 WS02040.B21_L16 PTxN-IB-N-A-11 Popul... 66 2e-009
gb|DT469319.1|DT469319 WS01917.C21_G13 PT-DX-N-A-10 Populus... 64 9e-009
gb|CV130907.1|CV130907 X9SP07g07 Populus stem seasonal libr... 58 5e-007
>gb|BU813476.1|BU813476 N010H08 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 410
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 66 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 118
>gb|CA926209.1|CA926209 MTU6CR.P11.C07 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 550
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 256 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 308
>gb|CB240336.1|CB240336 PopSC00315 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PopSC00315, mRNA sequence
Length = 444
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 309 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 361
>gb|CN524579.1|CN524579 GQ015M13.T3_C09 GQ015 Populus trichocarpa x Populus deltoides cDNA
clone GQ015M13_C09 5', mRNA sequence
Length = 510
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 138 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 190
>gb|AJ774952.1|AJ774952 AJ774952 Populus euphratica shoot 3-6 months Populus euphratica
cDNA clone P0000300026B08F1, mRNA sequence
Length = 566
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 189 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 241
>gb|CV265001.1|CV265001 WS02026.B21_B01 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02026_B01 3', mRNA sequence
Length = 907
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 439 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 387
>gb|CV276058.1|CV276058 WS0178.B21.1_H22 PTxD-NR-A-8 Populus trichocarpa x Populus
deltoides cDNA clone WS0178_H22 3', mRNA sequence
Length = 831
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 464 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 412
>gb|DN485521.1|DN485521 N010H08.3pR Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA clone N010H08 3', mRNA sequence
Length = 300
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 241 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 189
>gb|DN495006.1|DN495006 N010H08.5pR Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA clone N010H08 5', mRNA sequence
Length = 399
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 59 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 111
>gb|DT523819.1|DT523819 WS02040.B21_L16 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02040_L16 3', mRNA sequence
Length = 843
Score = 65.9 bits (33), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
|||||| | ||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 357 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 305
>gb|DT469319.1|DT469319 WS01917.C21_G13 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01917_G13 3', mRNA sequence
Length = 392
Score = 63.9 bits (32), Expect = 9e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 432 tccatccgcgccggcgccatctggatcaactgctacttcgcgtt 475
||||||||||| ||| |||| |||||||||||||||||||||||
Sbjct: 385 tccatccgcgcaggcaccatttggatcaactgctacttcgcgtt 342
>gb|CV130907.1|CV130907 X9SP07g07 Populus stem seasonal library Populus deltoides cDNA,
mRNA sequence
Length = 534
Score = 58.0 bits (29), Expect = 5e-007
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 423 gtgtcgcggtccatccgcgccggcgccatctggatcaactgctacttcg 471
|||||| | ||||||||||| ||| |||| |||||||||||||||||||
Sbjct: 37 gtgtcgagatccatccgcgcaggcaccatttggatcaactgctacttcg 85
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 69,770
Number of Sequences: 369679
Number of extensions: 69770
Number of successful extensions: 18301
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18289
Number of HSP's gapped (non-prelim): 12
length of query: 800
length of database: 203,408,664
effective HSP length: 19
effective length of query: 781
effective length of database: 196,384,763
effective search space: 153376499903
effective search space used: 153376499903
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)