BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2161285.2.2
         (798 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BI122281.1|BI122281  I004P65P Populus leaf cDNA library P...    42   0.032
gb|CA823251.1|CA823251  R23A11 two-month-old roots from clon...    42   0.032
gb|CK103910.1|CK103910  I004P65.5pR Populus senescing leaves...    42   0.032
gb|CK092919.1|CK092919  G100P11.3pR Populus tension wood cDN...    38   0.50 
gb|CV228827.1|CV228827  WS01911.B21_F18 PT-DX-N-A-10 Populus...    38   0.50 
gb|CX181022.1|CX181022  F07_45-15_11.ab1 leaf inoculated wit...    38   0.50 
gb|DT469652.1|DT469652  WS01918.C21_H10 PT-DX-N-A-10 Populus...    38   0.50 

>gb|BI122281.1|BI122281 I004P65P Populus leaf cDNA library Populus tremula x Populus
           tremuloides cDNA, mRNA sequence
          Length = 593

 Score = 42.1 bits (21), Expect = 0.032
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 46  attgtcttcaactcctggcaacactatggnactcctagctactggatgcaga 97
           ||||||||||||||||     |||||||| ||||| ||||||||| ||||||
Sbjct: 207 attgtcttcaactcctcaatgcactatggaactccaagctactgggtgcaga 258



>gb|CA823251.1|CA823251 R23A11 two-month-old roots from clone 'Beaupre' Populus trichocarpa
           x Populus deltoides cDNA 5', mRNA sequence
          Length = 536

 Score = 42.1 bits (21), Expect = 0.032
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 46  attgtcttcaactcctggcaacactatggnactcctagctactggatgcaga 97
           ||||||||||||||||     |||||||| ||||| ||||||||| ||||||
Sbjct: 85  attgtcttcaactcctcaatgcactatggaactccaagctactgggtgcaga 136



>gb|CK103910.1|CK103910 I004P65.5pR Populus senescing leaves cDNA library Populus tremula
           cDNA clone I004P65 5', mRNA sequence
          Length = 486

 Score = 42.1 bits (21), Expect = 0.032
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 46  attgtcttcaactcctggcaacactatggnactcctagctactggatgcaga 97
           ||||||||||||||||     |||||||| ||||| ||||||||| ||||||
Sbjct: 209 attgtcttcaactcctcaatgcactatggaactccaagctactgggtgcaga 260



>gb|CK092919.1|CK092919 G100P11.3pR Populus tension wood cDNA library Populus tremula x
           Populus tremuloides cDNA clone G100P11 3', mRNA sequence
          Length = 807

 Score = 38.2 bits (19), Expect = 0.50
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 377 tgaaaagccagctgagcaa 395
           |||||||||||||||||||
Sbjct: 91  tgaaaagccagctgagcaa 109



>gb|CV228827.1|CV228827 WS01911.B21_F18 PT-DX-N-A-10 Populus trichocarpa cDNA clone
           WS01911_F18 3', mRNA sequence
          Length = 765

 Score = 38.2 bits (19), Expect = 0.50
 Identities = 42/50 (84%)
 Strand = Plus / Minus

                                                             
Query: 46  attgtcttcaactcctggcaacactatggnactcctagctactggatgca 95
           |||||||||||||| | |   |||||||| ||||| ||||||||| ||||
Sbjct: 652 attgtcttcaactcgtcgacgcactatggaactccaagctactgggtgca 603



>gb|CX181022.1|CX181022 F07_45-15_11.ab1 leaf inoculated with Marssonia pathogen of Populus
           euramericana Populus x canadensis cDNA, mRNA sequence
          Length = 512

 Score = 38.2 bits (19), Expect = 0.50
 Identities = 42/50 (84%)
 Strand = Plus / Plus

                                                             
Query: 46  attgtcttcaactcctggcaacactatggnactcctagctactggatgca 95
           |||||||||||||| | |   |||||||| ||||| ||||||||| ||||
Sbjct: 160 attgtcttcaactcgtcgacgcactatggaactccaagctactgggtgca 209



>gb|DT469652.1|DT469652 WS01918.C21_H10 PT-DX-N-A-10 Populus trichocarpa cDNA clone
           WS01918_H10 3', mRNA sequence
          Length = 790

 Score = 38.2 bits (19), Expect = 0.50
 Identities = 42/50 (84%)
 Strand = Plus / Minus

                                                             
Query: 46  attgtcttcaactcctggcaacactatggnactcctagctactggatgca 95
           |||||||||||||| | |   |||||||| ||||| ||||||||| ||||
Sbjct: 652 attgtcttcaactcgtcgacgcactatggaactccaagctactgggtgca 603



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 72,175
Number of Sequences: 369679
Number of extensions: 72175
Number of successful extensions: 20668
Number of sequences better than  0.5: 7
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 20662
Number of HSP's gapped (non-prelim): 12
length of query: 798
length of database: 203,408,664
effective HSP length: 19
effective length of query: 779
effective length of database: 196,384,763
effective search space: 152983730377
effective search space used: 152983730377
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)