BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1804972.2.1
(1311 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AI164606.1|AI164606 A065P69U Hybrid aspen plasmid librar... 60 2e-007
gb|BU890521.1|BU890521 P038B02 Populus petioles cDNA librar... 60 2e-007
gb|CK088674.1|CK088674 A065P69.3pR Hybrid aspen plasmid lib... 60 2e-007
gb|CX171591.1|CX171591 B05_69-93_03.ab1 leaf inoculated wit... 60 2e-007
gb|CK096397.1|CK096397 UB12CPF02.3pR Populus active cambium... 52 6e-005
gb|CX173686.1|CX173686 E12_re-69-17_10.ab1 leaf inoculated ... 52 6e-005
gb|CX176766.1|CX176766 D03_69-3_07.ab1 leaf inoculated with... 52 6e-005
gb|CX178098.1|CX178098 B11_45-55_03.ab1 leaf inoculated wit... 48 9e-004
>gb|AI164606.1|AI164606 A065P69U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 393
Score = 60.0 bits (30), Expect = 2e-007
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 666 ataaacccagcgatggttattggtcccctgctgcagcctacactaaataccagtgctg 723
||||| ||||| ||||| |||||||| || ||||||||||||||||||| |||||||
Sbjct: 108 ataaatccagcaatggtaattggtcctctcttgcagcctacactaaatacaagtgctg 165
>gb|BU890521.1|BU890521 P038B02 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 576
Score = 60.0 bits (30), Expect = 2e-007
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 666 ataaacccagcgatggttattggtcccctgctgcagcctacactaaataccagtgctg 723
||||| ||||| ||||| |||||||| || ||||||||||||||||||| |||||||
Sbjct: 99 ataaatccagcaatggtaattggtcctctcttgcagcctacactaaatacaagtgctg 156
>gb|CK088674.1|CK088674 A065P69.3pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A065P69 3', mRNA sequence
Length = 780
Score = 60.0 bits (30), Expect = 2e-007
Identities = 51/58 (87%)
Strand = Plus / Minus
Query: 666 ataaacccagcgatggttattggtcccctgctgcagcctacactaaataccagtgctg 723
||||| ||||| ||||| |||||||| || ||||||||||||||||||| |||||||
Sbjct: 636 ataaatccagcaatggtaattggtcctctcttgcagcctacactaaatacaagtgctg 579
>gb|CX171591.1|CX171591 B05_69-93_03.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 610
Score = 60.0 bits (30), Expect = 2e-007
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 666 ataaacccagcgatggttattggtcccctgctgcagcctacactaaataccagtgctg 723
||||| ||||| |||||||||||||| || ||||||| ||||||||||| |||||||
Sbjct: 157 ataaatccagcaatggttattggtcctctcttgcagccaacactaaatacaagtgctg 214
>gb|CK096397.1|CK096397 UB12CPF02.3pR Populus active cambium cDNA library Populus tremula
cDNA clone UB12CPF02 3', mRNA sequence
Length = 535
Score = 52.0 bits (26), Expect = 6e-005
Identities = 50/58 (86%)
Strand = Plus / Minus
Query: 666 ataaacccagcgatggttattggtcccctgctgcagcctacactaaataccagtgctg 723
||||| ||||| ||||| |||||||| || |||||| |||||||||||| |||||||
Sbjct: 504 ataaatccagcaatggtaattggtcctctcttgcagcgtacactaaatacaagtgctg 447
>gb|CX173686.1|CX173686 E12_re-69-17_10.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 557
Score = 52.0 bits (26), Expect = 6e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 666 ataaacccagcgatggttattggtcccctgctgcagcctacactaaataccagtgctg 723
||||| ||||| ||||| |||||||| || ||||||| ||||||||||| |||||||
Sbjct: 157 ataaatccagcaatggtaattggtcctctcttgcagccaacactaaatacaagtgctg 214
>gb|CX176766.1|CX176766 D03_69-3_07.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 593
Score = 52.0 bits (26), Expect = 6e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 666 ataaacccagcgatggttattggtcccctgctgcagcctacactaaataccagtgctg 723
||||| ||||| ||||| |||||||| || ||||||| ||||||||||| |||||||
Sbjct: 129 ataaatccagcaatggtaattggtcctctcttgcagccaacactaaatacaagtgctg 186
>gb|CX178098.1|CX178098 B11_45-55_03.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 657
Score = 48.1 bits (24), Expect = 9e-004
Identities = 66/80 (82%)
Strand = Plus / Plus
Query: 357 actgcctctcccttttatcacaatgtcaaggatgctaaggcagagttacttgacccagca 416
||||| ||||| |||||||| |||||||||| | |||||||||| ||||| || |||
Sbjct: 271 actgcatctcctttttatcatgatgtcaaggacccacaggcagagttgcttgatcctgca 330
Query: 417 gttaagggaacactcaatgt 436
|| || || |||||||||||
Sbjct: 331 gtgaaagggacactcaatgt 350
Score = 42.1 bits (21), Expect = 0.053
Identities = 45/53 (84%)
Strand = Plus / Plus
Query: 678 atggttattggtcccctgctgcagcctacactaaataccagtgctgaagcaat 730
|||||||||||||| || ||||||| ||||| ||||| ||| ||| ||||||
Sbjct: 595 atggttattggtcctctcttgcagccaacacttaatacaagttctgcagcaat 647
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 137,675
Number of Sequences: 369679
Number of extensions: 137675
Number of successful extensions: 37027
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37004
Number of HSP's gapped (non-prelim): 23
length of query: 1311
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1292
effective length of database: 196,384,763
effective search space: 253729113796
effective search space used: 253729113796
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)