BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131591.2.2
(1252 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY372451.1| Populus balsamifera subsp. trichocarpa x Pop... 76 4e-012
gb|BU823325.1|BU823325 UB51DPA05 Populus tremula cambium cD... 64 1e-008
dbj|D30657.1|POPPALB Populus kitakamiensis gene for phenyla... 60 2e-007
gb|BU818868.1|BU818868 UA35CPF07 Populus tremula cambium cD... 58 9e-007
gb|AI161898.1|AI161898 A009P06U Hybrid aspen plasmid librar... 56 3e-006
gb|AI162008.1|AI162008 A010P78U Hybrid aspen plasmid librar... 56 3e-006
gb|AI164434.1|AI164434 A061P41U Hybrid aspen plasmid librar... 56 3e-006
gb|AI164475.1|AI164475 A062P69U Hybrid aspen plasmid librar... 56 3e-006
gb|BI128074.1|BI128074 G070P45Y Populus cambium cDNA librar... 56 3e-006
gb|BI128745.1|BI128745 G080P81Y Populus cambium cDNA librar... 56 3e-006
gb|BI131274.1|BI131274 G118P12Y Populus cambium cDNA librar... 56 3e-006
gb|BI139293.1|BI139293 F128P55Y Populus flower cDNA library... 56 3e-006
gb|BU814155.1|BU814155 N025F10 Populus bark cDNA library Po... 56 3e-006
gb|BU818649.1|BU818649 UA32CPG10 Populus tremula cambium cD... 56 3e-006
gb|BU822025.1|BU822025 UB31BPG09 Populus tremula cambium cD... 56 3e-006
gb|BU837114.1|BU837114 T094G08 Populus apical shoot cDNA li... 56 3e-006
gb|BU837410.1|BU837410 T101E05 Populus apical shoot cDNA li... 56 3e-006
gb|BU875458.1|BU875458 V007D06 Populus flower cDNA library ... 56 3e-006
gb|BU896075.1|BU896075 X035B05 Populus wood cDNA library Po... 56 3e-006
gb|CA822019.1|CA822019 R02G04 two-month-old roots from clon... 56 3e-006
gb|CA824486.1|CA824486 R43B06 two-month-old roots from clon... 56 3e-006
gb|CA825218.1|CA825218 R55C09 two-month-old roots from clon... 56 3e-006
gb|CB833381.1|CB833381 R19H01 two-month-old roots from clon... 56 3e-006
gb|CF228870.1|CF228870 PtaXM0018D11D1107 Poplar cDNA librar... 56 3e-006
gb|CF230655.1|CF230655 PtaC0011C9C0905 Poplar cDNA library ... 56 3e-006
gb|CF231901.1|CF231901 PtaC0027B3B0303 Poplar cDNA library ... 56 3e-006
gb|CF233943.1|CF233943 PtaJXO0029E11E1109 Poplar cDNA libra... 56 3e-006
gb|CF234020.1|CF234020 PtaJXO1E8E0810 Poplar cDNA library f... 56 3e-006
gb|CF235180.1|CF235180 PtaJXT0019G3G0313 Poplar cDNA librar... 56 3e-006
gb|CK088614.1|CK088614 A062P45.3pR Hybrid aspen plasmid lib... 56 3e-006
gb|CK096594.1|CK096594 UB20CPA08.3pR Populus active cambium... 56 3e-006
gb|CK099324.1|CK099324 A062P45.5pR Hybrid aspen plasmid lib... 56 3e-006
gb|CK106412.1|CK106412 UB20CPA08.5pR Populus active cambium... 56 3e-006
gb|CN520361.1|CN520361 GQ0105.B3_L21 GQ010 Populus trichoca... 56 3e-006
gb|CN524297.1|CN524297 GQ015M13.T3_E04 GQ015 Populus tricho... 56 3e-006
gb|AJ767896.1|AJ767896 AJ767896 Populus euphratica leaf adu... 56 3e-006
gb|AJ776874.1|AJ776874 AJ776874 Populus euphratica root 3-6... 56 3e-006
gb|CV229258.1|CV229258 WS01912.B21_L16 PT-DX-N-A-10 Populus... 56 3e-006
gb|CV233718.1|CV233718 WS01212.B21_B24 PT-GT-FL-A-3 Populus... 56 3e-006
gb|CV235766.1|CV235766 WS01221.B21_H23 PT-GT-FL-A-3 Populus... 56 3e-006
gb|CV238620.1|CV238620 WS0127.B21.1_F23 PT-GT-FL-A-3 Populu... 56 3e-006
gb|CV239470.1|CV239470 WS0232.B21_I12 PT-MB-A-13 Populus tr... 56 3e-006
gb|CV239638.1|CV239638 WS0233.B21_A09 PT-MB-A-13 Populus tr... 56 3e-006
gb|CV246025.1|CV246025 WS0111.B21_A17 PT-P-FL-A-2 Populus t... 56 3e-006
gb|CV247313.1|CV247313 WS01117.B21_M05 PT-P-FL-A-2 Populus ... 56 3e-006
gb|CV264204.1|CV264204 WS02023.B21_O09 PTxN-IB-N-A-11 Popul... 56 3e-006
gb|CV264302.1|CV264302 WS02024.B21_C16 PTxN-IB-N-A-11 Popul... 56 3e-006
gb|CV265235.1|CV265235 WS02026.B21_L05 PTxN-IB-N-A-11 Popul... 56 3e-006
gb|CV270864.1|CV270864 WS0153.B21_C11 PTxN-IB-A-6 Populus t... 56 3e-006
gb|CV273376.1|CV273376 WS01710.B21_L19 PTxD-NR-A-8 Populus ... 56 3e-006
gb|CV277784.1|CV277784 WS0144.B21_I24 PTxD-IL-A-5 Populus t... 56 3e-006
gb|CX174736.1|CX174736 C01_69-106_05.ab1 leaf inoculated wi... 56 3e-006
gb|CX654321.1|CX654321 PO02018D03 Poplar SC cDNA library Po... 56 3e-006
gb|DT475519.1|DT475519 WS0127.BR_F23 PT-GT-FL-A-3 Populus t... 56 3e-006
gb|DT480208.1|DT480208 WS02528.BR_D19 PT-MB-N-A-15 Populus ... 56 3e-006
gb|DT485444.1|DT485444 WS02528.B21_D19 PT-MB-N-A-15 Populus... 56 3e-006
gb|DT493326.1|DT493326 WS0111.BR_A17 PT-P-FL-A-2 Populus tr... 56 3e-006
gb|DT494212.1|DT494212 WS01117.BR_M05 PT-P-FL-A-2 Populus t... 56 3e-006
gb|DT499199.1|DT499199 WS0117.BR_J13 PT-P-FL-A-2 Populus tr... 56 3e-006
gb|DT516914.1|DT516914 WS02432.B21_M10 PTxD-ICC-N-A-14 Popu... 56 3e-006
gb|DT523050.1|DT523050 WS02038.B21_K10 PTxN-IB-N-A-11 Popul... 56 3e-006
gb|DT525197.1|DT525197 WS02044.C21_L09 PTxN-IB-N-A-11 Popul... 56 3e-006
gb|BU817209.1|BU817209 UA14CPC02 Populus tremula cambium cD... 52 5e-005
gb|BU896180.1|BU896180 X036G06 Populus wood cDNA library Po... 52 5e-005
gb|CV249786.1|CV249786 WS01125.B21_E21 PT-P-FL-A-2 Populus ... 50 2e-004
dbj|D43802.1|POPPALG2BA Populus kitakamiensis gene for phen... 50 2e-004
gb|BI120990.1|BI120990 F026P37Y Populus flower cDNA library... 48 8e-004
gb|BI139123.1|BI139123 F124P18Y Populus flower cDNA library... 48 8e-004
gb|BU821190.1|BU821190 UB20CPB12 Populus tremula cambium cD... 48 8e-004
gb|BU824160.1|BU824160 UB61BPA12 Populus tremula cambium cD... 48 8e-004
gb|BU868440.1|BU868440 M115H01 Populus flower cDNA library ... 48 8e-004
gb|BU878168.1|BU878168 V043H08 Populus flower cDNA library ... 48 8e-004
gb|BU879012.1|BU879012 V054F04 Populus flower cDNA library ... 48 8e-004
gb|BU879200.1|BU879200 V057B10 Populus flower cDNA library ... 48 8e-004
gb|BU879423.1|BU879423 V059H11 Populus flower cDNA library ... 48 8e-004
gb|BU880432.1|BU880432 UM49TA04 Populus flower cDNA library... 48 8e-004
gb|BU881688.1|BU881688 UM66TB12 Populus flower cDNA library... 48 8e-004
gb|BU881979.1|BU881979 UM70TA11 Populus flower cDNA library... 48 8e-004
gb|BU882356.1|BU882356 UM76TA03 Populus flower cDNA library... 48 8e-004
gb|BU882443.1|BU882443 UM77TA09 Populus flower cDNA library... 48 8e-004
gb|BU882750.1|BU882750 UM81TG04 Populus flower cDNA library... 48 8e-004
gb|CA822042.1|CA822042 R03A04 two-month-old roots from clon... 48 8e-004
gb|CA824094.1|CA824094 R36D06 two-month-old roots from clon... 48 8e-004
gb|CA826253.1|CA826253 R75C01 two-month-old roots from clon... 48 8e-004
gb|CB239863.1|CB239863 RSH17G09 two-month-old roots from cl... 48 8e-004
gb|CB833380.1|CB833380 R19G08 two-month-old roots from clon... 48 8e-004
gb|CF234295.1|CF234295 PtaJXO4G8G0814 Poplar cDNA library f... 48 8e-004
gb|CK105732.1|CK105732 UA35CPF07.5pR Populus dormant cambiu... 48 8e-004
gb|CN521048.1|CN521048 GQ0106.B3_C18 GQ010 Populus trichoca... 48 8e-004
gb|AJ768138.1|AJ768138 AJ768138 Populus euphratica leaf adu... 48 8e-004
gb|CV226936.1|CV226936 WS0165.B21_L12 PT-DX-A-7 Populus tri... 48 8e-004
gb|CV235502.1|CV235502 WS0122.B21_G09 PT-GT-FL-A-3 Populus ... 48 8e-004
gb|CV236405.1|CV236405 WS01223.B21_P19 PT-GT-FL-A-3 Populus... 48 8e-004
gb|CV238345.1|CV238345 WS0126.B21_E07 PT-GT-FL-A-3 Populus ... 48 8e-004
gb|CV238671.1|CV238671 WS0127.B21.1_J04 PT-GT-FL-A-3 Populu... 48 8e-004
gb|CV246312.1|CV246312 WS0111.B21_P20 PT-P-FL-A-2 Populus t... 48 8e-004
gb|CV246408.1|CV246408 WS01110.B21_G06 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV246593.1|CV246593 WS01111.B21_D17 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV246862.1|CV246862 WS01116.B21_D06 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV246967.1|CV246967 WS01116.B21_J14 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV248032.1|CV248032 WS0112.B21_C22 PT-P-FL-A-2 Populus t... 48 8e-004
gb|CV248779.1|CV248779 WS01121.B21_O23 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV248944.1|CV248944 WS01122.B21_H21 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV249229.1|CV249229 WS01123.B21_H01 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV249337.1|CV249337 WS01123.B21_M21 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV249606.1|CV249606 WS01124.B21_L21 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV249828.1|CV249828 WS01125.B21_H01 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV250109.1|CV250109 WS01126.B21_G06 PT-P-FL-A-2 Populus ... 48 8e-004
gb|CV251028.1|CV251028 WS0115.B21_J21 PT-P-FL-A-2 Populus t... 48 8e-004
gb|CV252081.1|CV252081 WS0119.B21_F09 PT-P-FL-A-2 Populus t... 48 8e-004
gb|CV252089.1|CV252089 WS0119.B21_G01 PT-P-FL-A-2 Populus t... 48 8e-004
gb|CV252141.1|CV252141 WS0119.B21_J12 PT-P-FL-A-2 Populus t... 48 8e-004
gb|CV254151.1|CV254151 WS0224.B21_D01 PTxD-ICC-A-12 Populus... 48 8e-004
gb|CV255583.1|CV255583 WS02414.B21_G22 PTxD-ICC-N-A-14 Popu... 48 8e-004
gb|CV260004.1|CV260004 WS02012.B21_O03 PTxN-IB-N-A-11 Popul... 48 8e-004
gb|CV261475.1|CV261475 WS02016.B21_O04 PTxN-IB-N-A-11 Popul... 48 8e-004
gb|CV263885.1|CV263885 WS02023.B21_A19 PTxN-IB-N-A-11 Popul... 48 8e-004
gb|CV265068.1|CV265068 WS02026.B21_D21 PTxN-IB-N-A-11 Popul... 48 8e-004
gb|CV272773.1|CV272773 WS0158.B21_K16 PTxN-IB-A-6 Populus t... 48 8e-004
gb|CV274011.1|CV274011 WS01712.B21_O15 PTxD-NR-A-8 Populus ... 48 8e-004
gb|CX178737.1|CX178737 A11_45-62_01.ab1 leaf inoculated wit... 48 8e-004
gb|CX181826.1|CX181826 E07_45-46_09.ab1 leaf inoculated wit... 48 8e-004
gb|CX185706.1|CX185706 A06_45-18_02.ab1 leaf inoculated wit... 48 8e-004
gb|CX186156.1|CX186156 G04_45-48_14.ab1 leaf inoculated wit... 48 8e-004
gb|CX186480.1|CX186480 F12_45-27_12.ab1 leaf inoculated wit... 48 8e-004
gb|DN492048.1|DN492048 V042H08.3pR Populus male catkins cDN... 48 8e-004
gb|DN501992.1|DN501992 V042H08.5pR Populus male catkins cDN... 48 8e-004
gb|DT471559.1|DT471559 WS01214.BR_E09 PT-GT-FL-A-3 Populus ... 48 8e-004
gb|DT471883.1|DT471883 WS0122.BR_G09 PT-GT-FL-A-3 Populus t... 48 8e-004
gb|DT475175.1|DT475175 WS0126.BR_E07 PT-GT-FL-A-3 Populus t... 48 8e-004
gb|DT475585.1|DT475585 WS0127.BR_J04 PT-GT-FL-A-3 Populus t... 48 8e-004
gb|DT493638.1|DT493638 WS0111.BR_P20 PT-P-FL-A-2 Populus tr... 48 8e-004
gb|DT493706.1|DT493706 WS01116.BR_D06 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT493830.1|DT493830 WS01116.BR_J14 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT495036.1|DT495036 WS0112.BR_C22 PT-P-FL-A-2 Populus tr... 48 8e-004
gb|DT495939.1|DT495939 WS01121.BR_O23 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT496127.1|DT496127 WS01122.BR_H21 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT496448.1|DT496448 WS01123.BR_H01 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT496577.1|DT496577 WS01123.BR_M21 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT496854.1|DT496854 WS01124.BR_L21 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT497037.1|DT497037 WS01125.BR_E21 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT497082.1|DT497082 WS01125.BR_H01 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT497410.1|DT497410 WS01126.BR_G06 PT-P-FL-A-2 Populus t... 48 8e-004
gb|DT498530.1|DT498530 WS0115.BR_J21 PT-P-FL-A-2 Populus tr... 48 8e-004
gb|DT499130.1|DT499130 WS0117.BR_G06 PT-P-FL-A-2 Populus tr... 48 8e-004
gb|DT499164.1|DT499164 WS0117.BR_H23 PT-P-FL-A-2 Populus tr... 48 8e-004
gb|DT499849.1|DT499849 WS9991.BR_I09 PT-P-FL-A-2 Populus tr... 48 8e-004
gb|DT499982.1|DT499982 WS9991.BR_O07 PT-P-FL-A-2 Populus tr... 48 8e-004
gb|DT500008.1|DT500008 WS9991.BR_P09 PT-P-FL-A-2 Populus tr... 48 8e-004
gb|DT500498.1|DT500498 PX0015.BR_K11 PT-X-FL-A-1 Populus tr... 48 8e-004
gb|DT506165.1|DT506165 WS01812.C21_N21 PTxD-IL-N-A-9 Populu... 48 8e-004
gb|DT522284.1|DT522284 WS02036.B21_J04 PTxN-IB-N-A-11 Popul... 48 8e-004
gb|BI131126.1|BI131126 G115P79Y Populus cambium cDNA librar... 44 0.013
gb|BU870990.1|BU870990 Q025F08 Populus flower cDNA library ... 44 0.013
gb|CB239545.1|CB239545 RSH13C06 two-month-old roots from cl... 44 0.013
dbj|D43803.1|POPPALG4B Populus kitakamiensis gene for pheny... 44 0.013
gb|AF480620.1| Populus tremuloides phenylalanine ammonia-ly... 44 0.013
gb|CF119538.1|CF119538 MTU10CS.P3.B08 Aspen stem cDNA Libra... 40 0.20
gb|CF227810.1|CF227810 PtaXM0004H6H0616 Poplar cDNA library... 40 0.20
gb|CF230231.1|CF230231 PtaC0005D7D0707 Poplar cDNA library ... 40 0.20
gb|CF231246.1|CF231246 PtaC0019B12B1204 Poplar cDNA library... 40 0.20
gb|CF236094.1|CF236094 PtaJXT0030E8E0810 Poplar cDNA librar... 40 0.20
gb|CF236908.1|CF236908 PtaJXT8F4F0412 Poplar cDNA library f... 40 0.20
gb|CN518316.1|CN518316 GQ0094.B3_K01 GQ009 Populus trichoca... 40 0.20
gb|CN521473.1|CN521473 GQ0111.B3_E21 GQ011 Populus trichoca... 40 0.20
gb|CV131494.1|CV131494 L2P07g09 Populus stem seasonal libra... 40 0.20
gb|CV272909.1|CV272909 WS0171.B21_B09 PTxD-NR-A-8 Populus t... 40 0.20
gb|CV273879.1|CV273879 WS01712.B21_H18 PTxD-NR-A-8 Populus ... 40 0.20
gb|CV274434.1|CV274434 WS0173.B21_E08 PTxD-NR-A-8 Populus t... 40 0.20
gb|CV274622.1|CV274622 WS0173.B21_O01 PTxD-NR-A-8 Populus t... 40 0.20
gb|CX168353.1|CX168353 D01_69-80_07.ab1 leaf inoculated wit... 40 0.20
gb|CX168950.1|CX168950 F12_69-63_12.ab1 leaf inoculated wit... 40 0.20
gb|CX169807.1|CX169807 H07_69-72_15.ab1 leaf inoculated wit... 40 0.20
gb|DT501329.1|DT501329 WS01312.BR_G01 PTxD-IL-FL-A-4 Populu... 40 0.20
gb|DT501631.1|DT501631 WS01313.BR_I19 PTxD-IL-FL-A-4 Populu... 40 0.20
gb|DT504193.1|DT504193 WS01312.B21_G01 PTxD-IL-FL-A-4 Popul... 40 0.20
gb|DT504486.1|DT504486 WS01313.B21_I19 PTxD-IL-FL-A-4 Popul... 40 0.20
>gb|AY372451.1| Populus balsamifera subsp. trichocarpa x Populus deltoides
phenylalanine ammonia lyase (PAL) mRNA, complete cds
Length = 2136
Score = 75.8 bits (38), Expect = 4e-012
Identities = 119/146 (81%)
Strand = Plus / Minus
Query: 54 gcccagggagttcacgtcctggttgtgctgctccgcgctctgcacgtggttggtgatggg 113
|||||||||||| || || |||||||| |||||||| ||||| || || ||||||| ||
Sbjct: 1467 gcccagggagttgacatcttggttgtgttgctccgcactctggacatgattggtgacagg 1408
Query: 114 gttgcccaggtactggagctcggagcagtaggacgccatggcgatctcggtgcccttgaa 173
||| | ||| | |||||||| |||||||| || |||||||| || |||| || |||||
Sbjct: 1407 attggcaaggaattggagctccgagcagtaagatgccatggcaatttcggcacctttgaa 1348
Query: 174 cccgtagtccaggctcgggttgcggc 199
|||||| |||| ||| || |||||||
Sbjct: 1347 cccgtaatccaagcttggattgcggc 1322
>gb|BU823325.1|BU823325 UB51DPA05 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 586
Score = 63.9 bits (32), Expect = 1e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||||||||||||||||||||
Sbjct: 394 tatgattttgattttgtgactgcagaggatgtccagaagagcag 437
>dbj|D30657.1|POPPALB Populus kitakamiensis gene for phenylalanine ammonia-lyase, complete
cds, clone palg2a
Length = 4080
Score = 60.0 bits (30), Expect = 2e-007
Identities = 114/142 (80%)
Strand = Plus / Minus
Query: 58 agggagttcacgtcctggttgtgctgctccgcgctctgcacgtggttggtgatggggttg 117
|||||||| || || |||||||| ||||| || ||||| || || ||||||| || |||
Sbjct: 2958 agggagttgacatcttggttgtgttgctcagcactctggacatgattggtgacaggattg 2899
Query: 118 cccaggtactggagctcggagcagtaggacgccatggcgatctcggtgcccttgaacccg 177
| ||| | |||||||| |||||||| || |||||||| || |||| || |||||||||
Sbjct: 2898 gcaaggaattggagctccgagcagtaagatgccatggcaatttcggcacctttgaacccg 2839
Query: 178 tagtccaggctcgggttgcggc 199
|| |||| ||| || |||||||
Sbjct: 2838 taatccaagcttggattgcggc 2817
>gb|BU818868.1|BU818868 UA35CPF07 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 470
Score = 58.0 bits (29), Expect = 9e-007
Identities = 46/52 (88%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcaggatcttct 797
|||||||| || ||||| ||||||||| |||||||||||||||| || ||||
Sbjct: 374 tatgattttgattttgtgactgcagagaatgtccagaagagcagaatnttct 425
>gb|AI161898.1|AI161898 A009P06U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 525
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 161 tatgattttgattttgtgactgcagagaatgtccagaagagcag 204
>gb|AI162008.1|AI162008 A010P78U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 664
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 318 tatgattttgattttgtgactgcagagaatgtccagaagagcag 361
>gb|AI164434.1|AI164434 A061P41U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 431
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 327 tatgattttgattttgtgactgcagagaatgtccagaagagcag 370
>gb|AI164475.1|AI164475 A062P69U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 440
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 132 tatgattttgattttgtgactgcagagaatgtccagaagagcag 175
>gb|BI128074.1|BI128074 G070P45Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 526
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 350 tatgattttgattttgtgactgcagagaatgtccagaagagcag 393
>gb|BI128745.1|BI128745 G080P81Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 556
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 537 tatgattttgattttgtgactgcagagaatgtccagaagagcag 494
>gb|BI131274.1|BI131274 G118P12Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 489
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 308 tatgattttgattttgtgactgcagagaatgtccagaagagcag 351
>gb|BI139293.1|BI139293 F128P55Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 467
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 365 tatgattttgattttgtgactgcagagaatgtccagaagagcag 408
>gb|BU814155.1|BU814155 N025F10 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 547
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 138 tatgattttgattttgtgactgcagagaatgtccagaagagcag 181
>gb|BU818649.1|BU818649 UA32CPG10 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 441
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 358 tatgattttgattttgtgactgcagagaatgtccagaagagcag 401
>gb|BU822025.1|BU822025 UB31BPG09 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 553
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 259 tatgattttgattttgtgactgcagagaatgtccagaagagcag 302
>gb|BU837114.1|BU837114 T094G08 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 719
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 388 tatgattttgattttgtgactgcagagaatgtccagaagagcag 431
>gb|BU837410.1|BU837410 T101E05 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 751
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 351 tatgattttgattttgtgactgcagagaatgtccagaagagcag 394
>gb|BU875458.1|BU875458 V007D06 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 768
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 364 tatgattttgattttgtgactgcagagaatgtccagaagagcag 407
>gb|BU896075.1|BU896075 X035B05 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 659
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 119 tatgattttgattttgtgactgcagagaatgtccagaagagcag 162
>gb|CA822019.1|CA822019 R02G04 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 650
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 362 tatgattttgattttgtgactgcagagaatgtccagaagagcag 405
>gb|CA824486.1|CA824486 R43B06 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 515
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 377 tatgattttgattttgtgactgcagagaatgtccagaagagcag 420
>gb|CA825218.1|CA825218 R55C09 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 484
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 312 tatgattttgattttgtgactgcagagaatgtccagaagagcag 355
>gb|CB833381.1|CB833381 R19H01 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 575
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 400 tatgattttgattttgtgactgcagagaatgtccagaagagcag 443
>gb|CF228870.1|CF228870 PtaXM0018D11D1107 Poplar cDNA library from mature xylem Populus
alba x Populus tremula cDNA 5', mRNA sequence
Length = 696
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 383 tatgattttgattttgtgactgcagagaatgtccagaagagcag 426
>gb|CF230655.1|CF230655 PtaC0011C9C0905 Poplar cDNA library from cambial zone Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 604
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 217 tatgattttgattttgtgactgcagagaatgtccagaagagcag 260
>gb|CF231901.1|CF231901 PtaC0027B3B0303 Poplar cDNA library from cambial zone Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 586
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 374 tatgattttgattttgtgactgcagagaatgtccagaagagcag 417
>gb|CF233943.1|CF233943 PtaJXO0029E11E1109 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 585
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 382 tatgattttgattttgtgactgcagagaatgtccagaagagcag 425
>gb|CF234020.1|CF234020 PtaJXO1E8E0810 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 772
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 371 tatgattttgattttgtgactgcagagaatgtccagaagagcag 414
>gb|CF235180.1|CF235180 PtaJXT0019G3G0313 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 655
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 375 tatgattttgattttgtgactgcagagaatgtccagaagagcag 418
>gb|CK088614.1|CK088614 A062P45.3pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A062P45 3', mRNA sequence
Length = 763
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 635 tatgattttgattttgtgactgcagagaatgtccagaagagcag 592
>gb|CK096594.1|CK096594 UB20CPA08.3pR Populus active cambium cDNA library Populus tremula
cDNA clone UB20CPA08 3', mRNA sequence
Length = 864
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 490 tatgattttgattttgtgactgcagagaatgtccagaagagcag 447
>gb|CK099324.1|CK099324 A062P45.5pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A062P45 5', mRNA sequence
Length = 554
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 148 tatgattttgattttgtgactgcagagaatgtccagaagagcag 191
>gb|CK106412.1|CK106412 UB20CPA08.5pR Populus active cambium cDNA library Populus tremula
cDNA clone UB20CPA08 5', mRNA sequence
Length = 660
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 408 tatgattttgattttgtgactgcagagaatgtccagaagagcag 451
>gb|CN520361.1|CN520361 GQ0105.B3_L21 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0105_L21 5', mRNA sequence
Length = 862
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 367 tatgattttgattttgtgactgcagagaatgtccagaagagcag 410
>gb|CN524297.1|CN524297 GQ015M13.T3_E04 GQ015 Populus trichocarpa x Populus deltoides cDNA
clone GQ015M13_E04 5', mRNA sequence
Length = 832
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 316 tatgattttgattttgtgactgcagagaatgtccagaagagcag 359
>gb|AJ767896.1|AJ767896 AJ767896 Populus euphratica leaf adult Populus euphratica cDNA
clone P0000100011G02F1, mRNA sequence
Length = 625
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 215 tatgattttgattttgtgactgcagagaatgtccagaagagcag 258
>gb|AJ776874.1|AJ776874 AJ776874 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400019G04F1, mRNA sequence
Length = 336
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 137 tatgattttgattttgtgactgcagagaatgtccagaagagcag 180
>gb|CV229258.1|CV229258 WS01912.B21_L16 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01912_L16 3', mRNA sequence
Length = 747
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 539 tatgattttgattttgtgactgcagagaatgtccagaagagcag 496
>gb|CV233718.1|CV233718 WS01212.B21_B24 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01212_B24 3', mRNA sequence
Length = 851
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 547 tatgattttgattttgtgactgcagagaatgtccagaagagcag 504
>gb|CV235766.1|CV235766 WS01221.B21_H23 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01221_H23 3', mRNA sequence
Length = 634
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 538 tatgattttgattttgtgactgcagagaatgtccagaagagcag 495
>gb|CV238620.1|CV238620 WS0127.B21.1_F23 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0127_F23 3', mRNA sequence
Length = 734
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 547 tatgattttgattttgtgactgcagagaatgtccagaagagcag 504
>gb|CV239470.1|CV239470 WS0232.B21_I12 PT-MB-A-13 Populus trichocarpa cDNA clone WS0232_I12
3', mRNA sequence
Length = 776
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 569 tatgattttgattttgtgactgcagagaatgtccagaagagcag 526
>gb|CV239638.1|CV239638 WS0233.B21_A09 PT-MB-A-13 Populus trichocarpa cDNA clone WS0233_A09
3', mRNA sequence
Length = 727
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 549 tatgattttgattttgtgactgcagagaatgtccagaagagcag 506
>gb|CV246025.1|CV246025 WS0111.B21_A17 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS0111_A17 3', mRNA sequence
Length = 732
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 550 tatgattttgattttgtgactgcagagaatgtccagaagagcag 507
>gb|CV247313.1|CV247313 WS01117.B21_M05 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01117_M05 3', mRNA sequence
Length = 922
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 691 tatgattttgattttgtgactgcagagaatgtccagaagagcag 648
>gb|CV264204.1|CV264204 WS02023.B21_O09 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02023_O09 3', mRNA sequence
Length = 871
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 505 tatgattttgattttgtgactgcagagaatgtccagaagagcag 462
>gb|CV264302.1|CV264302 WS02024.B21_C16 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02024_C16 3', mRNA sequence
Length = 892
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 536 tatgattttgattttgtgactgcagagaatgtccagaagagcag 493
>gb|CV265235.1|CV265235 WS02026.B21_L05 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02026_L05 3', mRNA sequence
Length = 828
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 569 tatgattttgattttgtgactgcagagaatgtccagaagagcag 526
>gb|CV270864.1|CV270864 WS0153.B21_C11 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0153_C11 3', mRNA sequence
Length = 898
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 536 tatgattttgattttgtgactgcagagaatgtccagaagagcag 493
>gb|CV273376.1|CV273376 WS01710.B21_L19 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS01710_L19 3', mRNA sequence
Length = 767
Score = 56.0 bits (28), Expect = 3e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 746 tatgatttcgactttgttactgcagaggatgtccagaagagcag 789
|||||||| || ||||| ||||||||| ||||||||||||||||
Sbjct: 538 tatgattttgattttgtgactgcagagaatgtccagaagagcag 495
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 111,101
Number of Sequences: 369679
Number of extensions: 111101
Number of successful extensions: 30844
Number of sequences better than 0.5: 177
Number of HSP's better than 0.5 without gapping: 172
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 30563
Number of HSP's gapped (non-prelim): 288
length of query: 1252
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1233
effective length of database: 196,384,763
effective search space: 242142412779
effective search space used: 242142412779
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)