BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131554.2.6
(761 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU868910.1|BU868910 M123F10 Populus flower cDNA library ... 145 3e-033
gb|BU879538.1|BU879538 V061D11 Populus flower cDNA library ... 145 3e-033
gb|BU879759.1|BU879759 UM37TA10 Populus flower cDNA library... 145 3e-033
gb|BU883450.1|BU883450 UM90TH12 Populus flower cDNA library... 145 3e-033
gb|BU883500.1|BU883500 UM91TE10 Populus flower cDNA library... 145 3e-033
gb|CA823650.1|CA823650 R29D04 two-month-old roots from clon... 145 3e-033
gb|CA823658.1|CA823658 R29E02 two-month-old roots from clon... 145 3e-033
gb|CV277856.1|CV277856 WS0144.B21_M04 PTxD-IL-A-5 Populus t... 145 3e-033
gb|DV463560.1|DV463560 MTUNUL1.P17.E05 NUL Populus fremonti... 135 3e-030
gb|DV465699.1|DV465699 MTUNUL1.P42.A06 NUL Populus fremonti... 135 3e-030
gb|DV466064.1|DV466064 MTUNUL1.P46.H03 NUL Populus fremonti... 135 3e-030
gb|DT501430.1|DT501430 WS01312.BR_M07 PTxD-IL-FL-A-4 Populu... 131 4e-029
gb|CA824081.1|CA824081 R36B09 two-month-old roots from clon... 129 2e-028
gb|AJ779481.1|AJ779481 AJ779481 Populus euphratica root 3-6... 129 2e-028
gb|BI138692.1|BI138692 F113P66Y Populus flower cDNA library... 127 7e-028
gb|CK101021.1|CK101021 F017P55.5pR Populus flower cDNA libr... 127 7e-028
gb|CV243805.1|CV243805 WS0252.B21_O09 PT-MB-N-A-15 Populus ... 127 7e-028
gb|DN484195.1|DN484195 F018P77.3pR Populus flower cDNA libr... 127 7e-028
gb|BI119654.1|BI119654 F003P11Y Populus flower cDNA library... 123 1e-026
gb|CX186932.1|CX186932 E06_45-32_10.ab1 leaf inoculated wit... 121 4e-026
gb|BU825069.1|BU825069 UK103C01 Populus apical shoot cDNA l... 119 2e-025
gb|BU825694.1|BU825694 UK112TA04 Populus apical shoot cDNA ... 119 2e-025
gb|BU826784.1|BU826784 UK124TG07 Populus apical shoot cDNA ... 119 2e-025
gb|BU826813.1|BU826813 UK125TB05 Populus apical shoot cDNA ... 119 2e-025
gb|BU828157.1|BU828157 K017P56P Populus apical shoot cDNA l... 119 2e-025
gb|BU838033.1|BU838033 T108G07 Populus apical shoot cDNA li... 119 2e-025
gb|CA925964.1|CA925964 MTU7TL.P8.C08 Aspen leaf cDNA Librar... 119 2e-025
gb|CN550143.1|CN550143 GQ0244.B3_F10 GQ024 Populus trichoca... 119 2e-025
gb|AJ774210.1|AJ774210 AJ774210 Populus euphratica shoot 3-... 119 2e-025
gb|CV274982.1|CV274982 WS0174.B21.1_P21 PTxD-NR-A-8 Populus... 119 2e-025
gb|CX167578.1|CX167578 C03_69-32_05.ab1 leaf inoculated wit... 119 2e-025
gb|CX168756.1|CX168756 D04_69-96_08.ab1 leaf inoculated wit... 119 2e-025
gb|CX169845.1|CX169845 E12_69-36_10.ab1 leaf inoculated wit... 119 2e-025
gb|CX170418.1|CX170418 B04_69-59_04.ab1 leaf inoculated wit... 119 2e-025
gb|CX172243.1|CX172243 H07_69-37_15.ab1 leaf inoculated wit... 119 2e-025
gb|CX172618.1|CX172618 C02_69-55_06.ab1 leaf inoculated wit... 119 2e-025
gb|CX175560.1|CX175560 D11_69-117_07.ab1 leaf inoculated wi... 119 2e-025
gb|CX175890.1|CX175890 A01_69-95_01.ab1 leaf inoculated wit... 119 2e-025
gb|CV273825.1|CV273825 WS01712.B21_E15 PTxD-NR-A-8 Populus ... 117 6e-025
gb|CA933995.1|CA933995 MTU3TS.P1.E01 Aspen stem cDNA Librar... 113 1e-023
gb|CK100843.1|CK100843 F002P36.5pR Populus flower cDNA libr... 113 1e-023
gb|CX656253.1|CX656253 PO02051A01 Poplar SC cDNA library Po... 113 1e-023
gb|BU837496.1|BU837496 T102E01 Populus apical shoot cDNA li... 111 4e-023
gb|CX178383.1|CX178383 H03_45-79_15.ab1 leaf inoculated wit... 111 4e-023
gb|DT481588.1|DT481588 WS02532.BR_F03 PT-MB-N-A-15 Populus ... 109 2e-022
gb|DT524942.1|DT524942 WS02044.C21_A05 PTxN-IB-N-A-11 Popul... 109 2e-022
gb|BU819908.1|BU819908 UA49BPA05 Populus tremula cambium cD... 107 6e-022
gb|BU829614.1|BU829614 K045P11P Populus apical shoot cDNA l... 107 6e-022
gb|CA821310.1|CA821310 RSH01C10 two-month-old roots from cl... 107 6e-022
gb|CA823535.1|CA823535 R27F12 two-month-old roots from clon... 107 6e-022
gb|CA825393.1|CA825393 R58B06 two-month-old roots from clon... 107 6e-022
gb|CA825457.1|CA825457 R59C02 two-month-old roots from clon... 107 6e-022
gb|CA826260.1|CA826260 R75D02 two-month-old roots from clon... 107 6e-022
gb|CV226906.1|CV226906 WS0165.B21_K04 PT-DX-A-7 Populus tri... 107 6e-022
gb|CV248318.1|CV248318 WS01120.B21_E04 PT-P-FL-A-2 Populus ... 107 6e-022
gb|DT494475.1|DT494475 WS01118.BR.1_I13 PT-P-FL-A-2 Populus... 107 6e-022
gb|DT495367.1|DT495367 WS01120.BR_E04 PT-P-FL-A-2 Populus t... 107 6e-022
gb|BI138232.1|BI138232 F101P66Y Populus flower cDNA library... 105 2e-021
gb|BU863821.1|BU863821 S032G04 Populus imbibed seed cDNA li... 105 2e-021
gb|CA929569.1|CA929569 MTU2CA.P15.F05 Aspen apex cDNA Libra... 105 2e-021
gb|CF230989.1|CF230989 PtaC0016A2A0202 Poplar cDNA library ... 105 2e-021
gb|CF231065.1|CF231065 PtaC0016H3H0315 Poplar cDNA library ... 105 2e-021
gb|CV225507.1|CV225507 WS0161.B21_J17 PT-DX-A-7 Populus tri... 105 2e-021
gb|CV232962.1|CV232962 WS0199.B21_D13 PT-DX-N-A-10 Populus ... 105 2e-021
gb|BU828233.1|BU828233 K019P03P Populus apical shoot cDNA l... 103 1e-020
gb|BU828242.1|BU828242 K019P20P Populus apical shoot cDNA l... 103 1e-020
gb|CA926260.1|CA926260 MTU6CR.P11.H10 Aspen root cDNA Libra... 103 1e-020
gb|CA926413.1|CA926413 MTU6CR.P14.G04 Aspen root cDNA Libra... 103 1e-020
gb|CK090389.1|CK090389 F002P36.3pR Populus flower cDNA libr... 103 1e-020
gb|CK097569.1|CK097569 UB55BPA02.3pR Populus active cambium... 103 1e-020
gb|CV282251.1|CV282251 WS0184.B21_C01 PTxD-IL-N-A-9 Populus... 103 1e-020
gb|CA930784.1|CA930784 MTU2TA.P10.B11 Aspen apex cDNA Libra... 100 2e-019
gb|CV261077.1|CV261077 WS02015.B21_M19 PTxN-IB-N-A-11 Popul... 100 2e-019
gb|BI121322.1|BI121322 F034P18Y Populus flower cDNA library... 98 6e-019
gb|BI121842.1|BI121842 F048P21Y Populus flower cDNA library... 98 6e-019
gb|BI135936.1|BI135936 F060P72Y Populus flower cDNA library... 98 6e-019
gb|BI136534.1|BI136534 F069P65Y Populus flower cDNA library... 98 6e-019
gb|BI137499.1|BI137499 F087P13Y Populus flower cDNA library... 98 6e-019
gb|BI137599.1|BI137599 F089P14Y Populus flower cDNA library... 98 6e-019
gb|BI137662.1|BI137662 F091P30Y Populus flower cDNA library... 98 6e-019
gb|BU824959.1|BU824959 UK101TH02 Populus apical shoot cDNA ... 98 6e-019
gb|BU825016.1|BU825016 UK102E12 Populus apical shoot cDNA l... 98 6e-019
gb|BU861443.1|BU861443 S002B05 Populus imbibed seed cDNA li... 98 6e-019
gb|CA929704.1|CA929704 MTU2CA.P1.E07 Aspen apex cDNA Librar... 98 6e-019
gb|CA929914.1|CA929914 MTU2CA.P4.D05 Aspen apex cDNA Librar... 98 6e-019
gb|CA929996.1|CA929996 MTU2CA.P5.F09 Aspen apex cDNA Librar... 98 6e-019
gb|CA930070.1|CA930070 MTU2CA.P6.F09 Aspen apex cDNA Librar... 98 6e-019
gb|CA930538.1|CA930538 MTU4CA.P23.G03 Aspen apex cDNA Libra... 98 6e-019
gb|CF236272.1|CF236272 PtaJXT10G6G0614 Poplar cDNA library ... 98 6e-019
gb|CK107367.1|CK107367 UB55BPA02.5pR Populus active cambium... 98 6e-019
gb|CV256319.1|CV256319 WS0243.B21_I12 PTxD-ICC-N-A-14 Popul... 98 6e-019
gb|DT496673.1|DT496673 WS01124.BR_B21 PT-P-FL-A-2 Populus t... 98 6e-019
gb|DT499059.1|DT499059 WS0117.BR_C18 PT-P-FL-A-2 Populus tr... 98 6e-019
gb|BU837052.1|BU837052 T094B03 Populus apical shoot cDNA li... 94 9e-018
gb|BI121111.1|BI121111 F028P83Y Populus flower cDNA library... 92 4e-017
gb|BU822587.1|BU822587 UB39BPF05 Populus tremula cambium cD... 92 4e-017
gb|BU829589.1|BU829589 K044P74P Populus apical shoot cDNA l... 92 4e-017
gb|CK097118.1|CK097118 UB39BPF05.3pR Populus active cambium... 92 4e-017
gb|CK106935.1|CK106935 UB39BPF05.5pR Populus active cambium... 92 4e-017
gb|CV244273.1|CV244273 WS0254.B21_D08 PT-MB-N-A-15 Populus ... 92 4e-017
gb|CV251103.1|CV251103 WS0115.B21_N14 PT-P-FL-A-2 Populus t... 92 4e-017
gb|CX168256.1|CX168256 C08_69-60_06.ab1 leaf inoculated wit... 92 4e-017
gb|CX170102.1|CX170102 E01_69-42_09.ab1 leaf inoculated wit... 92 4e-017
gb|CX170792.1|CX170792 A03_69-97_01.ab1 leaf inoculated wit... 92 4e-017
gb|DN489724.1|DN489724 T073H04.3pR Populus shoot meristem c... 92 4e-017
gb|DN499638.1|DN499638 T073H04.5pR Populus shoot meristem c... 92 4e-017
gb|DT498612.1|DT498612 WS0115.BR_N14 PT-P-FL-A-2 Populus tr... 92 4e-017
gb|BU826005.1|BU826005 UK115TF01 Populus apical shoot cDNA ... 90 1e-016
gb|BU827569.1|BU827569 K005P30P Populus apical shoot cDNA l... 90 1e-016
gb|BU832768.1|BU832768 T038A06 Populus apical shoot cDNA li... 90 1e-016
gb|BU870691.1|BU870691 Q017C02 Populus flower cDNA library ... 90 1e-016
gb|BU890720.1|BU890720 P040G10 Populus petioles cDNA librar... 90 1e-016
gb|CA924697.1|CA924697 MTU7CL.P8.H09 Aspen leaf cDNA Librar... 90 1e-016
gb|CA929485.1|CA929485 MTU2CA.P14.D12 Aspen apex cDNA Libra... 90 1e-016
gb|CA929502.1|CA929502 MTU2CA.P14.G01 Aspen apex cDNA Libra... 90 1e-016
gb|CA823858.1|CA823858 R32E04 two-month-old roots from clon... 90 1e-016
gb|CA823872.1|CA823872 R32G01 two-month-old roots from clon... 90 1e-016
gb|CA824281.1|CA824281 R39C12 two-month-old roots from clon... 90 1e-016
gb|CA925842.1|CA925842 MTU7TL.P6.F02 Aspen leaf cDNA Librar... 88 6e-016
gb|AJ769085.1|AJ769085 AJ769085 Populus euphratica leaf adu... 88 6e-016
gb|BI135514.1|BI135514 F053P61Y Populus flower cDNA library... 84 9e-015
gb|BU827711.1|BU827711 K007P61P Populus apical shoot cDNA l... 84 9e-015
gb|CA823941.1|CA823941 R33H02 two-month-old roots from clon... 84 9e-015
gb|BI119617.1|BI119617 F002P36Y Populus flower cDNA library... 82 4e-014
gb|BU811449.1|BU811449 UL84TE01 Populus leaf cDNA library P... 82 4e-014
gb|BU814468.1|BU814468 N030aB04 Populus bark cDNA library P... 82 4e-014
gb|BU814550.1|BU814550 N030bB04 Populus bark cDNA library P... 82 4e-014
gb|BU828229.1|BU828229 K018P95P Populus apical shoot cDNA l... 82 4e-014
gb|BU829895.1|BU829895 T001D07 Populus apical shoot cDNA li... 82 4e-014
gb|CK097584.1|CK097584 UB55BPF01.3pR Populus active cambium... 82 4e-014
gb|CK107382.1|CK107382 UB55BPF01.5pR Populus active cambium... 82 4e-014
gb|CK109030.1|CK109030 K018P95 Populus apical shoot cDNA li... 82 4e-014
gb|CK109846.1|CK109846 N030B04 Populus bark cDNA library Po... 82 4e-014
gb|CK113269.1|CK113269 UR105TB09 Populus root cDNA library ... 82 4e-014
gb|CV273997.1|CV273997 WS01712.B21_N23 PTxD-NR-A-8 Populus ... 82 4e-014
gb|BU823647.1|BU823647 UB55BPA02 Populus tremula cambium cD... 80 1e-013
gb|CA823688.1|CA823688 R29G12 two-month-old roots from clon... 80 1e-013
gb|BU833901.1|BU833901 T054B02 Populus apical shoot cDNA li... 76 2e-012
gb|CA821551.1|CA821551 RSH04D02 two-month-old roots from cl... 76 2e-012
gb|CA822166.1|CA822166 R04E08 two-month-old roots from clon... 76 2e-012
gb|CA826311.1|CA826311 R76B06 two-month-old roots from clon... 76 2e-012
gb|DT516404.1|DT516404 WS02431.B21_E12 PTxD-ICC-N-A-14 Popu... 76 2e-012
gb|BU823703.1|BU823703 UB55BPF01 Populus tremula cambium cD... 74 9e-012
gb|BU835536.1|BU835536 T075B10 Populus apical shoot cDNA li... 74 9e-012
gb|BU886832.1|BU886832 R051B04 Populus root cDNA library Po... 74 9e-012
gb|BU891070.1|BU891070 P045E07 Populus petioles cDNA librar... 74 9e-012
gb|BI120631.1|BI120631 F019P40Y Populus flower cDNA library... 70 1e-010
gb|BU827586.1|BU827586 K005P10P Populus apical shoot cDNA l... 70 1e-010
gb|BU867886.1|BU867886 M105E08 Populus flower cDNA library ... 70 1e-010
gb|BU884738.1|BU884738 R014H03 Populus root cDNA library Po... 70 1e-010
gb|CN522719.1|CN522719 GQ0123.B3_L24 GQ012 Populus trichoca... 70 1e-010
gb|DT524681.1|DT524681 WS02043.C21_F01 PTxN-IB-N-A-11 Popul... 68 5e-010
gb|CV261168.1|CV261168 WS02016.B21_A19 PTxN-IB-N-A-11 Popul... 66 2e-009
gb|CV283933.1|CV283933 WS0188.B21_K24 PTxD-IL-N-A-9 Populus... 66 2e-009
gb|BU835967.1|BU835967 T080H09 Populus apical shoot cDNA li... 64 8e-009
gb|BI071500.1|BI071500 C058P46U Populus strain T89 leaves P... 62 3e-008
gb|CF227467.1|CF227467 PtaD6D10D1008 Poplar cDNA library fr... 62 3e-008
gb|CK113977.1|CK113977 V014F05 Populus male catkins cDNA li... 58 5e-007
gb|BI125791.1|BI125791 I066P09P Populus leaf cDNA library P... 56 2e-006
gb|CA821221.1|CA821221 RA01C01 three-week-old roots incubat... 56 2e-006
gb|CA822865.1|CA822865 R14H07 two-month-old roots from clon... 56 2e-006
gb|CK095037.1|CK095037 I066P09.3pR Populus senescing leaves... 56 2e-006
gb|CK109455.1|CK109455 N016H07 Populus bark cDNA library Po... 56 2e-006
gb|CK110554.1|CK110554 N067H12 Populus bark cDNA library Po... 56 2e-006
gb|CK115342.1|CK115342 Y008C11 Populus infected leaf substr... 56 2e-006
gb|AJ778781.1|AJ778781 AJ778781 Populus euphratica cambium ... 54 8e-006
gb|BI126029.1|BI126029 I069P45P Populus leaf cDNA library P... 52 3e-005
gb|BU831180.1|BU831180 T018D09 Populus apical shoot cDNA li... 52 3e-005
gb|BU837158.1|BU837158 T095D08 Populus apical shoot cDNA li... 52 3e-005
gb|CV265553.1|CV265553 WS02027.B21_J08 PTxN-IB-N-A-11 Popul... 52 3e-005
gb|AJ775111.1|AJ775111 AJ775111 Populus euphratica shoot 3-... 50 1e-004
gb|AJ778111.1|AJ778111 AJ778111 Populus euphratica root 3-6... 50 1e-004
gb|CA930762.1|CA930762 MTU2TA.P8.F09 Aspen apex cDNA Librar... 46 0.002
gb|AJ771201.1|AJ771201 AJ771201 Populus euphratica leaf 3-6... 46 0.002
gb|AJ772586.1|AJ772586 AJ772586 Populus euphratica shoot in... 46 0.002
gb|CF230727.1|CF230727 PtaC0012C2C0206 Poplar cDNA library ... 44 0.008
gb|CV270314.1|CV270314 WS0151.B21_K14 PTxN-IB-A-6 Populus t... 42 0.030
gb|CV272093.1|CV272093 WS0156.B21.1_K03 PTxN-IB-A-6 Populus... 42 0.030
gb|DT524408.1|DT524408 WS02042.C21.1_J03 PTxN-IB-N-A-11 Pop... 42 0.030
gb|DT525779.1|DT525779 WS02046.C21_E09 PTxN-IB-N-A-11 Popul... 42 0.030
gb|BI123786.1|BI123786 I028P77P Populus leaf cDNA library P... 40 0.12
gb|CK090636.1|CK090636 F017P55.3pR Populus flower cDNA libr... 40 0.12
>gb|BU868910.1|BU868910 M123F10 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 532
Score = 145 bits (73), Expect = 3e-033
Identities = 202/245 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 350 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 291
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 290 atgacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 231
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 230 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 171
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 170 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 111
Query: 664 ccctt 668
|||||
Sbjct: 110 ccctt 106
>gb|BU879538.1|BU879538 V061D11 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 521
Score = 145 bits (73), Expect = 3e-033
Identities = 202/245 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 339 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 280
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 279 atgacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 220
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 219 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 160
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 159 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 100
Query: 664 ccctt 668
|||||
Sbjct: 99 ccctt 95
>gb|BU879759.1|BU879759 UM37TA10 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 527
Score = 145 bits (73), Expect = 3e-033
Identities = 202/245 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 345 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 286
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 285 atgacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 226
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 225 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 166
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 165 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 106
Query: 664 ccctt 668
|||||
Sbjct: 105 ccctt 101
>gb|BU883450.1|BU883450 UM90TH12 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 455
Score = 145 bits (73), Expect = 3e-033
Identities = 202/245 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 344 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 285
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 284 atgacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 225
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 224 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 165
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 164 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 105
Query: 664 ccctt 668
|||||
Sbjct: 104 ccctt 100
>gb|BU883500.1|BU883500 UM91TE10 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 526
Score = 145 bits (73), Expect = 3e-033
Identities = 202/245 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 344 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 285
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| |||||||||||||||||||| ||||| || ||||| | || |
Sbjct: 284 atgacattctccaggaagatcttgagcacaccgcgagtctcttcatagatcaagccactg 225
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||| ||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 224 atacgcttgaccccacccatccgagcaagacggcggattgcaggctttgtgataccttga 165
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 164 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 105
Query: 664 ccctt 668
|||||
Sbjct: 104 ccctt 100
>gb|CA823650.1|CA823650 R29D04 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 569
Score = 145 bits (73), Expect = 3e-033
Identities = 202/245 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 359 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 300
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 299 atgacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 240
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 239 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 180
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 179 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 120
Query: 664 ccctt 668
|||||
Sbjct: 119 ccctt 115
>gb|CA823658.1|CA823658 R29E02 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 600
Score = 145 bits (73), Expect = 3e-033
Identities = 202/245 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 355 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 296
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 295 atgacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 236
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 235 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 176
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 175 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 116
Query: 664 ccctt 668
|||||
Sbjct: 115 ccctt 111
>gb|CV277856.1|CV277856 WS0144.B21_M04 PTxD-IL-A-5 Populus trichocarpa x Populus deltoides
cDNA clone WS0144_M04 3', mRNA sequence
Length = 577
Score = 145 bits (73), Expect = 3e-033
Identities = 202/245 (82%)
Strand = Plus / Plus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 250 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 309
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 310 atgacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 369
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 370 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 429
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 430 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 489
Query: 664 ccctt 668
|||||
Sbjct: 490 ccctt 494
>gb|DV463560.1|DV463560 MTUNUL1.P17.E05 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 582
Score = 135 bits (68), Expect = 3e-030
Identities = 212/260 (81%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| || |||||||||||||| || ||||| |||||||| ||||| || | |
Sbjct: 356 acatccatggcagtaacggtcttgcggcgagcatgctcagtgtaggtcacggcatctctg 297
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| || |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 296 ataacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 237
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | |||||||| ||||| ||||| || ||
Sbjct: 236 atacgcttgaccccacccctccgagcaagacggcggatcgcaggctttgtgataccttga 177
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 176 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 117
Query: 664 cccttgccgcgccccgacat 683
||||| || ||||| |||||
Sbjct: 116 ccctttccacgcccagacat 97
>gb|DV465699.1|DV465699 MTUNUL1.P42.A06 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 598
Score = 135 bits (68), Expect = 3e-030
Identities = 212/260 (81%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| || |||||||||||||| || ||||| |||||||| ||||| || | |
Sbjct: 369 acatccatggcagtaacggtcttgcggcgagcatgctcagtgtaggtcacggcatctctg 310
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| || |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 309 ataacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 250
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | |||||||| ||||| ||||| || ||
Sbjct: 249 atacgcttgaccccacccctccgagcaagacggcggatcgcaggctttgtgataccttga 190
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 189 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 130
Query: 664 cccttgccgcgccccgacat 683
||||| || ||||| |||||
Sbjct: 129 ccctttccacgcccagacat 110
>gb|DV466064.1|DV466064 MTUNUL1.P46.H03 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 858
Score = 135 bits (68), Expect = 3e-030
Identities = 212/260 (81%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| || |||||||||||||| || ||||| |||||||| ||||| || | |
Sbjct: 848 acatccatggcagtaacggtcttgcggcgagcatgctcagtgtaggtcacggcatctctg 789
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| || |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 788 ataacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 729
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | |||||||| ||||| ||||| || ||
Sbjct: 728 atacgcttgaccccacccctccgagcaagacggcggatcgcaggctttgtgataccttga 669
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 668 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 609
Query: 664 cccttgccgcgccccgacat 683
||||| || ||||| |||||
Sbjct: 608 ccctttccacgcccagacat 589
>gb|DT501430.1|DT501430 WS01312.BR_M07 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS01312_M07 5', mRNA sequence
Length = 551
Score = 131 bits (66), Expect = 4e-029
Identities = 201/245 (82%), Gaps = 2/245 (0%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 344 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 285
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| ||||||||||||||||| || |||| || ||||| | || |
Sbjct: 284 atgacattctccaggaagatcttgagcacaccacgagtct--tcatagatcaagccactg 227
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 226 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 167
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 166 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 107
Query: 664 ccctt 668
|||||
Sbjct: 106 ccctt 102
>gb|CA824081.1|CA824081 R36B09 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 546
Score = 129 bits (65), Expect = 2e-028
Identities = 200/245 (81%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| || |||||||||||||| || ||||| |||||||| ||||| || | |
Sbjct: 356 acatccatggcagtaacggtcttgcggcgagcatgctcagtgtaggtcacggcatctctg 297
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| || |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 296 ataacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 237
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | |||||| || ||||| ||||| || ||
Sbjct: 236 atacgcttgaccccacccctccgagcaagacgccggattgcaggctttgtgataccttga 177
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 176 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 117
Query: 664 ccctt 668
|||||
Sbjct: 116 ccctt 112
>gb|AJ779481.1|AJ779481 AJ779481 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000800003B08F1, mRNA sequence
Length = 598
Score = 129 bits (65), Expect = 2e-028
Identities = 200/245 (81%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| || |||||||||||||| || ||||| ||||| || ||||| || | |
Sbjct: 361 acatccatggcagtaacggtcttgcggcgagcatgctcagtgtacgtcacggcatctctg 302
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| || ||||| || ||||||||||||||||| || ||||| || ||||| | ||| |
Sbjct: 301 ataacattctcgaggaagatcttgagcacaccacgagtctcttcatagatcaagccgctg 242
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| |||||||||| ||| || | ||||| || ||||||||||| || ||
Sbjct: 241 atacgcttgaccccgcccctccgagcaagacggcggattgcaggcttggtgataccttga 182
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 181 atgttatcacgaaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 122
Query: 664 ccctt 668
|||||
Sbjct: 121 ccctt 117
>gb|BI138692.1|BI138692 F113P66Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 272
Score = 127 bits (64), Expect = 7e-028
Identities = 202/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 269 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcgtca 210
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 209 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 150
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 149 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 90
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 89 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 30
Query: 661 ccgccctt 668
|| |||||
Sbjct: 29 cctccctt 22
>gb|CK101021.1|CK101021 F017P55.5pR Populus flower cDNA library Populus trichocarpa cDNA
clone F017P55 5', mRNA sequence
Length = 481
Score = 127 bits (64), Expect = 7e-028
Identities = 202/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 280 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcgtca 221
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 220 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 161
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 160 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 101
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 100 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 41
Query: 661 ccgccctt 668
|| |||||
Sbjct: 40 cctccctt 33
>gb|CV243805.1|CV243805 WS0252.B21_O09 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS0252_O09 3', mRNA sequence
Length = 505
Score = 127 bits (64), Expect = 7e-028
Identities = 202/248 (81%)
Strand = Plus / Plus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 237 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcgtca 296
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 297 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 356
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 357 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 416
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 417 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 476
Query: 661 ccgccctt 668
|| |||||
Sbjct: 477 cctccctt 484
>gb|DN484195.1|DN484195 F018P77.3pR Populus flower cDNA library Populus trichocarpa cDNA
clone F018P77 3', mRNA sequence
Length = 417
Score = 127 bits (64), Expect = 7e-028
Identities = 202/248 (81%)
Strand = Plus / Plus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 138 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcgtca 197
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 198 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 257
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 258 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 317
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 318 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 377
Query: 661 ccgccctt 668
|| |||||
Sbjct: 378 cctccctt 385
>gb|BI119654.1|BI119654 F003P11Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 291
Score = 123 bits (62), Expect = 1e-026
Identities = 203/249 (81%), Gaps = 1/249 (0%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 267 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcgtca 208
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 207 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagncca 148
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 147 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 88
Query: 601 tggatgttgtcgcgcaggaccttgcgg-tggcgcttggcgccgcccttgcccagaccctt 659
|||||||| || || || ||||| ||| || | |||||| || ||||| |||| |||||
Sbjct: 87 tggatgttatcacgaagaaccttacggatgcctcttggcccctccctttcccaatccctt 28
Query: 660 gccgccctt 668
||| |||||
Sbjct: 27 gcctccctt 19
>gb|CX186932.1|CX186932 E06_45-32_10.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 487
Score = 121 bits (61), Expect = 4e-026
Identities = 199/245 (81%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| || |||||||||||||| || ||||| |||||||| ||||| || | |
Sbjct: 258 acatccatggcagtaacggtcttgcggcgagcatgctcagtgtaggtcacggcatctctg 199
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| ||||||||||| |||||||||||||| || || ||||| || ||||| | || |
Sbjct: 198 ataacgttctccaggaagatcttgagcacgccacgagtctcttcatagatcaagccactg 139
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 138 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 79
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 78 atgttatcacggaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 19
Query: 664 ccctt 668
|||||
Sbjct: 18 ccctt 14
>gb|BU825069.1|BU825069 UK103C01 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 480
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 262 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 203
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 202 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 143
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 142 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 83
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 82 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 23
Query: 661 ccgccctt 668
|| |||||
Sbjct: 22 cctccctt 15
>gb|BU825694.1|BU825694 UK112TA04 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 479
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 262 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 203
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 202 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 143
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 142 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 83
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 82 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 23
Query: 661 ccgccctt 668
|| |||||
Sbjct: 22 cctccctt 15
>gb|BU826784.1|BU826784 UK124TG07 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 480
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 262 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 203
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 202 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 143
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 142 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 83
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 82 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 23
Query: 661 ccgccctt 668
|| |||||
Sbjct: 22 cctccctt 15
>gb|BU826813.1|BU826813 UK125TB05 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 472
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 262 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 203
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 202 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 143
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 142 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 83
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 82 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 23
Query: 661 ccgccctt 668
|| |||||
Sbjct: 22 cctccctt 15
>gb|BU828157.1|BU828157 K017P56P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 484
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 262 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 203
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 202 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 143
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 142 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 83
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 82 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 23
Query: 661 ccgccctt 668
|| |||||
Sbjct: 22 cctccctt 15
>gb|BU838033.1|BU838033 T108G07 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 482
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 263 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 204
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 203 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 144
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 143 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 84
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 83 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 24
Query: 661 ccgccctt 668
|| |||||
Sbjct: 23 cctccctt 16
>gb|CA925964.1|CA925964 MTU7TL.P8.C08 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 309
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Plus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 24 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 83
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 84 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 143
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 144 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcgggcttggtgataccc 203
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 204 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 263
Query: 661 ccgccctt 668
|| |||||
Sbjct: 264 cctccctt 271
>gb|CN550143.1|CN550143 GQ0244.B3_F10 GQ024 Populus trichocarpa x Populus deltoides cDNA
clone GQ0244_F10 5', mRNA sequence
Length = 472
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 251 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 192
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 191 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 132
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 131 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 72
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 71 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 12
Query: 661 ccgccctt 668
|| |||||
Sbjct: 11 cccccctt 4
>gb|AJ774210.1|AJ774210 AJ774210 Populus euphratica shoot 3-6 months Populus euphratica
cDNA clone P0000300014B10F1, mRNA sequence
Length = 455
Score = 119 bits (60), Expect = 2e-025
Identities = 192/236 (81%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
|||||||| || || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 266 acatccattgcagtcactgtcttgcggcgagcatgctctgtgtaggtgaccgcatcacga 207
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| || |||||||| ||||||||||| ||||| | ||| || |||||||| ||||| |
Sbjct: 206 atcacattctccaggaagatcttgaggacacctctggtttcttcgtagataagcccactg 147
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| ||||| || ||||| | ||||||||| | || ||||| ||||||||||||||||||
Sbjct: 146 atacgcttaactccgccacgcctagccagtcgacgaatcgcaggcttggtgatgccctgg 87
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagaccctt 659
||||| || || || ||||| || || | |||||| || ||||| ||||| |||||
Sbjct: 86 atgttatctcgaagaaccttacgatgcctcttggctcctccctttcccagtccctt 31
>gb|CV274982.1|CV274982 WS0174.B21.1_P21 PTxD-NR-A-8 Populus trichocarpa x Populus
deltoides cDNA clone WS0174_P21 3', mRNA sequence
Length = 431
Score = 119 bits (60), Expect = 2e-025
Identities = 156/188 (82%)
Strand = Plus / Plus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 237 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcgtca 296
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 297 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 356
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 357 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 416
Query: 601 tggatgtt 608
||||||||
Sbjct: 417 tggatgtt 424
>gb|CX167578.1|CX167578 C03_69-32_05.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 532
Score = 119 bits (60), Expect = 2e-025
Identities = 156/188 (82%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 314 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 255
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
||||| || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 254 cggatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 195
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 194 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 135
Query: 601 tggatgtt 608
||||||||
Sbjct: 134 tggatgtt 127
>gb|CX168756.1|CX168756 D04_69-96_08.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 531
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 295 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 236
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 235 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 176
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 175 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 116
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 115 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 56
Query: 661 ccgccctt 668
|| |||||
Sbjct: 55 cccccctt 48
>gb|CX169845.1|CX169845 E12_69-36_10.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 531
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 314 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 255
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 254 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 195
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 194 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 135
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 134 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 75
Query: 661 ccgccctt 668
|| |||||
Sbjct: 74 cccccctt 67
>gb|CX170418.1|CX170418 B04_69-59_04.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 681
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 285 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 226
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 225 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 166
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 165 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 106
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 105 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 46
Query: 661 ccgccctt 668
|| |||||
Sbjct: 45 cccccctt 38
>gb|CX172243.1|CX172243 H07_69-37_15.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 514
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 295 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 236
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 235 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 176
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 175 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 116
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 115 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 56
Query: 661 ccgccctt 668
|| |||||
Sbjct: 55 cccccctt 48
>gb|CX172618.1|CX172618 C02_69-55_06.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 504
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 289 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 230
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 229 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 170
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 169 atgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 110
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 109 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 50
Query: 661 ccgccctt 668
|| |||||
Sbjct: 49 cccccctt 42
>gb|CX175560.1|CX175560 D11_69-117_07.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 643
Score = 119 bits (60), Expect = 2e-025
Identities = 192/236 (81%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
|||||||| || || || ||||||||||| || ||||| ||||||||||| || |||||
Sbjct: 306 acatccattgcagtcactgtcttgcggcgagcatgctctgtgtaggtgactgcatcacga 247
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| || |||||||| ||||||||||| ||||| | ||| || |||||||| ||||| |
Sbjct: 246 atcacattctccaggaagatcttgaggacacctctggtttcttcgtagataagcccactg 187
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| ||||| | ||||||||| | || ||||| |||||||||||||||||
Sbjct: 186 atacgcttgactccgccacgcctagccagtcgacgaatcgcaggcttggtgatgccctga 127
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagaccctt 659
||||| || || || ||||| || || | |||||| || ||||| ||||| |||||
Sbjct: 126 atgttatctcgaagaaccttacgatgcctcttggctcctccctttcccagtccctt 71
>gb|CX175890.1|CX175890 A01_69-95_01.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 515
Score = 119 bits (60), Expect = 2e-025
Identities = 201/248 (81%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 291 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 232
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 231 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 172
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 171 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 112
Query: 601 tggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttg 660
|||||||| || || || ||||| || || | |||||| || ||||| |||| ||||||
Sbjct: 111 tggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatcccttg 52
Query: 661 ccgccctt 668
|| |||||
Sbjct: 51 cccccctt 44
>gb|CV273825.1|CV273825 WS01712.B21_E15 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS01712_E15 3', mRNA sequence
Length = 457
Score = 117 bits (59), Expect = 6e-025
Identities = 167/203 (82%)
Strand = Plus / Plus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||||||||||||||||| ||||| |||||||| ||||| || | |
Sbjct: 248 acatccatggcagtgacggtcttgcggcgggcatgctcagtgtaggtcacggcatctctg 307
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
||||| |||||||| ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 308 atgacattctccaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 367
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||||| ||| || | ||||| || ||||| ||||| || ||
Sbjct: 368 atacgcttgaccccacccctccgagcaagacggcggattgcaggctttgtgataccttga 427
Query: 604 atgttgtcgcgcaggaccttgcg 626
||||| || || |||||||||||
Sbjct: 428 atgttatcacgaaggaccttgcg 450
>gb|CA933995.1|CA933995 MTU3TS.P1.E01 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 438
Score = 113 bits (57), Expect = 1e-023
Identities = 198/245 (80%)
Strand = Plus / Plus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
|||||||||||||| |||||||||||||| || ||||| |||||||| ||||| || | |
Sbjct: 137 acatccatggcggtaacggtcttgcggcgagcatgctccgtgtaggtcacggcatctctg 196
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| || ||||| || ||||||||||||||||| || || || || ||||| | || |
Sbjct: 197 ataacattctcgaggaagatcttgagcacaccacgagtttcttcatagatcaagccactg 256
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| |||||||| | ||| || | ||||| || ||||| ||||| || ||
Sbjct: 257 atacgcttgaccccgcccctacgagcaagacggcggattgcaggctttgtgataccttga 316
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 317 atgttatcacggaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 376
Query: 664 ccctt 668
|||||
Sbjct: 377 ccctt 381
>gb|CK100843.1|CK100843 F002P36.5pR Populus flower cDNA library Populus trichocarpa cDNA
clone F002P36 5', mRNA sequence
Length = 653
Score = 113 bits (57), Expect = 1e-023
Identities = 202/249 (81%), Gaps = 1/249 (0%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 267 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcgtca 208
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 207 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 148
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgat-gcc 599
||| |||||||| || || | ||| || || | |||||||| ||||||||||| ||
Sbjct: 147 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 88
Query: 600 ctggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagaccctt 659
||||||||| || || || ||||| || || | |||||| || ||||| |||| |||||
Sbjct: 87 ctggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaatccctt 28
Query: 660 gccgccctt 668
||| |||||
Sbjct: 27 gcctccctt 19
>gb|CX656253.1|CX656253 PO02051A01 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO02051A01 5', mRNA sequence
Length = 531
Score = 113 bits (57), Expect = 1e-023
Identities = 198/245 (80%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
||||||||||| |||||| |||||||||| || |||||||||||||| |||||||| | |
Sbjct: 315 acatccatggcagtgacgttcttgcggcgagcatgctcggtgtaggtcacggcgtctctg 256
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| || ||||| || ||||||||||||||||| || ||||| || ||||| | || |
Sbjct: 255 ataacattctcgaggaagatcttgagcacaccacgagtctcttcatagatcaagccactg 196
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || ||||| | ||| || | || || || ||||| ||||| || ||
Sbjct: 195 atacgcttgaccccacccctacgagcaagacggcgtattgcaggctttgtgataccttga 136
Query: 604 atgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccagacccttgccg 663
||||| || || ||||||||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 135 atgttatcacggaggaccttgcgatgacgcttggctcctccctttcccaggcccttgcct 76
Query: 664 ccctt 668
|||||
Sbjct: 75 ccctt 71
>gb|BU837496.1|BU837496 T102E01 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 463
Score = 111 bits (56), Expect = 4e-023
Identities = 155/188 (82%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 262 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 203
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 202 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 143
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 142 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 83
Query: 601 tggatgtt 608
||||||||
Sbjct: 82 tggatgtt 75
>gb|CX178383.1|CX178383 H03_45-79_15.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 498
Score = 111 bits (56), Expect = 4e-023
Identities = 155/188 (82%)
Strand = Plus / Minus
Query: 421 acgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtca 480
||||||||||| || || || ||||||||||| |||||||| |||||||| || || |||
Sbjct: 246 acgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttacagcatca 187
Query: 481 cggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccg 540
|| || || |||||||| |||||||||||||| || | ||||||||||||||| || ||
Sbjct: 186 cgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagataagacca 127
Query: 541 gagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccc 600
||| |||||||| || || | ||| || || | |||||||| ||||||||||| |||
Sbjct: 126 ctgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtgataccc 67
Query: 601 tggatgtt 608
||||||||
Sbjct: 66 tggatgtt 59
>gb|DT481588.1|DT481588 WS02532.BR_F03 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02532_F03 5', mRNA sequence
Length = 826
Score = 109 bits (55), Expect = 2e-022
Identities = 157/191 (82%)
Strand = Plus / Plus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
|||||||| || || || ||||||||||| |||||||||||||| || || || |||||
Sbjct: 219 acatccattgcagtcactgtcttgcggcgagcgtgctcggtgtatgtcacagcatcacga 278
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| ||||||||||| ||||||||||| || || | |||||||||||||||||| || |
Sbjct: 279 atcacgttctccaggaagatcttgagaacgcctctggtctcctcgtagatgagaccactg 338
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || || | ||||||||| | || ||||| ||||| ||||| ||||||
Sbjct: 339 atacgcttgactcccccacgcctagccagacgacgaatcgcaggcttcgtgataccctgg 398
Query: 604 atgttgtcgcg 614
|| || |||||
Sbjct: 399 atattatcgcg 409
>gb|DT524942.1|DT524942 WS02044.C21_A05 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02044_A05 3', mRNA sequence
Length = 584
Score = 109 bits (55), Expect = 2e-022
Identities = 184/227 (81%)
Strand = Plus / Minus
Query: 379 ccgaagccgtagagggtgcggccctgtcgcttgagcgcgtagacgacatccatggcggtg 438
||||| ||||| || ||||||||||| | ||| | || || || |||||||| || ||
Sbjct: 351 ccgaacccgtatagtgtgcggccctgcctcttcaaagcatacacaacatccatagcagtc 292
Query: 439 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacggatgacgttctccaga 498
|| ||||||||||| |||||||||||||| || || || ||||| || |||||||||||
Sbjct: 291 acagtcttgcggcgagcgtgctcggtgtatgtcacagcatcacgaatcacgttctccagg 232
Query: 499 aagatcttgagcacaccgcgggtctcctcgtagatgagcccggagatgcgcttgacgccg 558
||||||||||| || || | |||||||||||||||||| || ||| |||||||| ||
Sbjct: 231 aagatcttgagaacgcctctggtctcctcgtagatgagaccactgatacgcttgactccc 172
Query: 559 cccctcctagccagcctccggatcgccggcttggtgatgccctggat 605
|| | ||||||||| | || ||||| ||||| ||||| ||||||||
Sbjct: 171 ccacgcctagccagacgacgaatcgcaggcttcgtgataccctggat 125
>gb|BU819908.1|BU819908 UA49BPA05 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 438
Score = 107 bits (54), Expect = 6e-022
Identities = 150/182 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
|||||||| || || |||||||||||||| |||||||||||||| || || || |||||
Sbjct: 313 acatccatagcagtcacggtcttgcggcgagcgtgctcggtgtatgtcacagcatcacga 254
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| ||||||||||| ||||||||||| || || | ||||||||||||||| || || |
Sbjct: 253 atcacgttctccaggaagatcttgagaacgcctctggtctcctcgtagataagaccaccg 194
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || || | ||||||||| | || ||||| ||||| ||||| ||||||
Sbjct: 193 atacgcttgactccaccacgcctagccagacgacgaatcgcaggcttcgtgataccctgg 134
Query: 604 at 605
||
Sbjct: 133 at 132
>gb|BU829614.1|BU829614 K045P11P Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 359
Score = 107 bits (54), Expect = 6e-022
Identities = 205/254 (80%), Gaps = 1/254 (0%)
Strand = Plus / Minus
Query: 415 gcgtagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacg 474
||||| ||||||||||| || || || ||||||||||| |||||||| |||||||| ||
Sbjct: 273 gcgtacacgacatccatagcagtcactgtcttgcggcgtgcgtgctctgtgtaggttaca 214
Query: 475 gcgtcacggatgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatg 534
|| ||||| || || |||||||| |||||||||||||| || | |||||||||||||||
Sbjct: 213 gcatcacgaatcacattctccaggaagatcttgagcacgcctctggtctcctcgtagata 154
Query: 535 agcccggagatgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtg 594
|| || ||| |||||||| || || | ||| || || | |||||||| |||||||||
Sbjct: 153 agaccactgatacgcttgacaccaccacgccttgctagacgacggatcgcaggcttggtg 94
Query: 595 atgccctggatgttgtcgcgcaggaccttgcggtggcgcttggcgccgcccttgcccaga 654
|| |||||||||| || || || ||||| || || | |||||| || ||||| ||||
Sbjct: 93 at-acctggatgttatcacgaagaaccttacgatgcctcttggcccctccctttcccaat 35
Query: 655 cccttgccgccctt 668
|||||||| |||||
Sbjct: 34 cccttgcctccctt 21
>gb|CA821310.1|CA821310 RSH01C10 two-month-old roots from clone 'Beaupre' grown for 19 days
under restricted irrigation Populus trichocarpa x
Populus deltoides cDNA 5', mRNA sequence
Length = 588
Score = 107 bits (54), Expect = 6e-022
Identities = 150/182 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
|||||||| || || || ||||||||||| |||||||||||||| || || || |||||
Sbjct: 322 acatccattgcagtcactgtcttgcggcgagcgtgctcggtgtatgtcacagcatcacga 263
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| ||||||||||| ||||||||||| || || | |||||||||||||||||| || |
Sbjct: 262 atcacgttctccaggaagatcttgagaacgcctctggtctcctcgtagatgagaccactg 203
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || || | ||||||||| | || ||||| ||||| ||||| ||||||
Sbjct: 202 atacgcttgactcccccacgcctagccagacgacgaatcgcaggcttcgtgataccctgg 143
Query: 604 at 605
||
Sbjct: 142 at 141
>gb|CA823535.1|CA823535 R27F12 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 567
Score = 107 bits (54), Expect = 6e-022
Identities = 150/182 (82%)
Strand = Plus / Minus
Query: 424 acatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcacgg 483
|||||||| || || || ||||||||||| |||||||||||||| || || || |||||
Sbjct: 320 acatccatagctgtcacagtcttgcggcgagcgtgctcggtgtatgtcacagcatcacga 261
Query: 484 atgacgttctccagaaagatcttgagcacaccgcgggtctcctcgtagatgagcccggag 543
|| ||||||||||| ||||||||||| || || | |||||||||||||||||| || |
Sbjct: 260 atcacgttctccaggaagatcttgagaacgcctctggtctcctcgtagatgagaccactg 201
Query: 544 atgcgcttgacgccgcccctcctagccagcctccggatcgccggcttggtgatgccctgg 603
|| |||||||| || || | ||||||||| | || ||||| ||||| ||||| ||||||
Sbjct: 200 atacgcttgactccaccacgcctagccagacgacgaatcgcaggcttcgtgataccctgg 141
Query: 604 at 605
||
Sbjct: 140 at 139
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 72,272
Number of Sequences: 369679
Number of extensions: 72272
Number of successful extensions: 20568
Number of sequences better than 0.5: 182
Number of HSP's better than 0.5 without gapping: 181
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 20247
Number of HSP's gapped (non-prelim): 298
length of query: 761
length of database: 203,408,664
effective HSP length: 19
effective length of query: 742
effective length of database: 196,384,763
effective search space: 145717494146
effective search space used: 145717494146
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)