BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.387
(908 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CX655836.1|CX655836 PO02040G07 Poplar SC cDNA library Po... 54 1e-005
gb|CX658483.1|CX658483 PO01035F02 Poplar SC cDNA library Po... 54 1e-005
gb|CX659018.1|CX659018 PO01025E01 Poplar SC cDNA library Po... 54 1e-005
gb|CX659039.1|CX659039 PO01025G05 Poplar SC cDNA library Po... 54 1e-005
gb|CX659801.1|CX659801 PO01014C09 Poplar SC cDNA library Po... 54 1e-005
gb|CX659804.1|CX659804 PO01014C12 Poplar SC cDNA library Po... 54 1e-005
gb|CA821239.1|CA821239 RA01E01 three-week-old roots incubat... 48 6e-004
gb|BI125794.1|BI125794 I066P14P Populus leaf cDNA library P... 46 0.002
gb|BU816847.1|BU816847 UA10BPA08 Populus tremula cambium cD... 46 0.002
gb|BU818936.1|BU818936 UA37BPD06 Populus tremula cambium cD... 46 0.002
gb|BU818950.1|BU818950 UA37BPE08 Populus tremula cambium cD... 46 0.002
gb|BU819999.1|BU819999 UA50BPB05 Populus tremula cambium cD... 46 0.002
gb|CA924071.1|CA924071 MTU7CL.P1.D04 Aspen leaf cDNA Librar... 46 0.002
gb|CA924288.1|CA924288 MTU7CL.P3.H12 Aspen leaf cDNA Librar... 46 0.002
gb|CA927240.1|CA927240 MTU6CR.P6.F08 Aspen root cDNA Librar... 46 0.002
gb|CK095894.1|CK095894 UA34CPE04.3pR Populus dormant cambiu... 46 0.002
gb|CK095940.1|CK095940 UA37BPE08.3pR Populus dormant cambiu... 46 0.002
gb|CK116138.1|CK116138 Y020E02 Populus infected leaf substr... 46 0.002
gb|CV276669.1|CV276669 WS0141.B21_H08 PTxD-IL-A-5 Populus t... 44 0.009
gb|CV282458.1|CV282458 WS0184.B21_K21 PTxD-IL-N-A-9 Populus... 44 0.009
gb|DT506052.1|DT506052 WS01812.C21_J02 PTxD-IL-N-A-9 Populu... 44 0.009
gb|DV464270.1|DV464270 MTUNUL1.P25.D08 NUL Populus fremonti... 44 0.009
gb|DV464681.1|DV464681 MTUNUL1.P3.E07 NUL Populus fremontii... 44 0.009
gb|DV464969.1|DV464969 MTUNUL1.P33.B05 NUL Populus fremonti... 44 0.009
emb|X59995.1|PTGWIN62B P.trichocarpa chitinase gene gwin6.2... 44 0.009
gb|DN485029.1|DN485029 M101D01.3pR Populus female catkins c... 40 0.14
>gb|CX655836.1|CX655836 PO02040G07 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO02040G07 5', mRNA sequence
Length = 185
Score = 54.0 bits (27), Expect = 1e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| || |||||||||||||| || || ||||||||||
Sbjct: 159 gtggcatgagggctttggagactgtggtgtcatccagaaccaaattgctgtcttgaagg 101
>gb|CX658483.1|CX658483 PO01035F02 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01035F02 5', mRNA sequence
Length = 427
Score = 54.0 bits (27), Expect = 1e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| || |||||||||||||| || || ||||||||||
Sbjct: 97 gtggcatgagggctttggagactgtggtgtcatccagaaccaaattgctgtcttgaagg 39
>gb|CX659018.1|CX659018 PO01025E01 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01025E01 5', mRNA sequence
Length = 417
Score = 54.0 bits (27), Expect = 1e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| || |||||||||||||| || || ||||||||||
Sbjct: 96 gtggcatgagggctttggagactgtggtgtcatccagaaccaaattgctgtcttgaagg 38
>gb|CX659039.1|CX659039 PO01025G05 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01025G05 5', mRNA sequence
Length = 558
Score = 54.0 bits (27), Expect = 1e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| || |||||||||||||| || || ||||||||||
Sbjct: 237 gtggcatgagggctttggagactgtggtgtcatccagaaccaaattgctgtcttgaagg 179
>gb|CX659801.1|CX659801 PO01014C09 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01014C09 5', mRNA sequence
Length = 397
Score = 54.0 bits (27), Expect = 1e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| || |||||||||||||| || || ||||||||||
Sbjct: 76 gtggcatgagggctttggagactgtggtgtcatccagaaccaaattgctgtcttgaagg 18
>gb|CX659804.1|CX659804 PO01014C12 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01014C12 5', mRNA sequence
Length = 471
Score = 54.0 bits (27), Expect = 1e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| || |||||||||||||| || || ||||||||||
Sbjct: 150 gtggcatgagggctttggagactgtggtgtcatccagaaccaaattgctgtcttgaagg 92
>gb|CA821239.1|CA821239 RA01E01 three-week-old roots incubated in 5uM indole-3-acetic acid
24h before harvesting Populus alba x Populus tremula
cDNA 5', mRNA sequence
Length = 650
Score = 48.1 bits (24), Expect = 6e-004
Identities = 52/60 (86%), Gaps = 1/60 (1%)
Strand = Plus / Minus
Query: 562 gtggcacgagggctt-gggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| ||| ||||| || |||||||||||||| || || ||||||||||
Sbjct: 287 gtggcatgagggctttgggagactgtggtgtcatccagaaccaaattgctgtcttgaagg 228
>gb|BI125794.1|BI125794 I066P14P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 419
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| | |||||||||||||| || || ||||||||||
Sbjct: 160 gtggcatgagggctttggagactgtgctgtcatccagaaccaaattgctgtcttgaagg 102
>gb|BU816847.1|BU816847 UA10BPA08 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 455
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| | |||||||||||||| || || ||||||||||
Sbjct: 152 gtggcatgagggctttggagactgtgctgtcatccagaaccaaattgctgtcttgaagg 94
>gb|BU818936.1|BU818936 UA37BPD06 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 586
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| | |||||||||||||| || || ||||||||||
Sbjct: 261 gtggcatgagggctttggagactgtgctgtcatccagaaccaaattgctgtcttgaagg 203
>gb|BU818950.1|BU818950 UA37BPE08 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 591
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| | |||||||||||||| || || ||||||||||
Sbjct: 239 gtggcatgagggctttggagactgtgctgtcatccagaaccaaattgctgtcttgaagg 181
>gb|BU819999.1|BU819999 UA50BPB05 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 576
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| | |||||||||||||| || || ||||||||||
Sbjct: 448 gtggcatgagggctttggagactgtgctgtcatccagaaccaaattgctgtcttgaagg 390
>gb|CA924071.1|CA924071 MTU7CL.P1.D04 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 648
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| | |||||||||||||| || || ||||||||||
Sbjct: 153 gtggcatgagggctttggagactgtgctgtcatccagaaccaaattgctgtcttgaagg 211
>gb|CA924288.1|CA924288 MTU7CL.P3.H12 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 660
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| | |||||||||||||| || || ||||||||||
Sbjct: 153 gtggcatgagggctttggagactgtgctgtcatccagaaccaaattgctgtcttgaagg 211
>gb|CA927240.1|CA927240 MTU6CR.P6.F08 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 653
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| | |||||||||||||| || || ||||||||||
Sbjct: 153 gtggcatgagggctttggagactgtgctgtcatccagaaccaaattgctgtcttgaagg 211
>gb|CK095894.1|CK095894 UA34CPE04.3pR Populus dormant cambium cDNA library Populus tremula
cDNA clone UA34CPE04 3', mRNA sequence
Length = 373
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||||| | |||||| ||||| || |||||||||||||
Sbjct: 207 gtggcatgagggctttggagactgcgctgccatccaaaaccaaattgccgtcttgaagg 265
>gb|CK095940.1|CK095940 UA37BPE08.3pR Populus dormant cambium cDNA library Populus tremula
cDNA clone UA37BPE08 3', mRNA sequence
Length = 583
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || ||||| | |||||||||||||| || || ||||||||||
Sbjct: 343 gtggcatgagggctttggagactgtgctgtcatccagaaccaaattgctgtcttgaagg 401
>gb|CK116138.1|CK116138 Y020E02 Populus infected leaf substracted cDNA library Populus
tremula cDNA clone Y020E02 5', mRNA sequence
Length = 404
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 562 gtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||| |||||||| || | ||| || |||||||||||||| || || ||||||||||
Sbjct: 177 gtggcatgagggctttggaggctgtggtgtcatccagaaccaaattgctgtcttgaagg 119
>gb|CV276669.1|CV276669 WS0141.B21_H08 PTxD-IL-A-5 Populus trichocarpa x Populus deltoides
cDNA clone WS0141_H08 3', mRNA sequence
Length = 884
Score = 44.1 bits (22), Expect = 0.009
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 560 gcgtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaag 619
||||| || |||||||| || ||||| || |||||||| ||||||| || |||||||||
Sbjct: 372 gcgtgacaagagggctttggggactgtggtgtcatccaaaaccagagtgctgtcttgaag 431
Query: 620 gc 621
||
Sbjct: 432 gc 433
>gb|CV282458.1|CV282458 WS0184.B21_K21 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS0184_K21 3', mRNA sequence
Length = 566
Score = 44.1 bits (22), Expect = 0.009
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 560 gcgtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaag 619
||||| || |||||||| || ||||| || |||||||| ||||||| || |||||||||
Sbjct: 405 gcgtgacaagagggctttggggactgtggtgtcatccaaaaccagagtgctgtcttgaag 464
Query: 620 gc 621
||
Sbjct: 465 gc 466
>gb|DT506052.1|DT506052 WS01812.C21_J02 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS01812_J02 3', mRNA sequence
Length = 850
Score = 44.1 bits (22), Expect = 0.009
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 560 gcgtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaag 619
||||| || |||||||| || ||||| || |||||||| ||||||| || |||||||||
Sbjct: 381 gcgtgacaagagggctttggggactgtggtgtcatccaaaaccagagtgctgtcttgaag 440
Query: 620 gc 621
||
Sbjct: 441 gc 442
>gb|DV464270.1|DV464270 MTUNUL1.P25.D08 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 876
Score = 44.1 bits (22), Expect = 0.009
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||||||||||| || ||||| | |||||||| ||||| || || ||||||||||
Sbjct: 736 tggcacgagggctttggagactgtgctgtcatccaaaaccaaattgctgtcttgaagg 679
>gb|DV464681.1|DV464681 MTUNUL1.P3.E07 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 702
Score = 44.1 bits (22), Expect = 0.009
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||||||||||| || ||||| | |||||||| ||||| || || ||||||||||
Sbjct: 690 tggcacgagggctttggagactgtgctgtcatccaaaaccaaattgctgtcttgaagg 633
>gb|DV464969.1|DV464969 MTUNUL1.P33.B05 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 959
Score = 44.1 bits (22), Expect = 0.009
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
|||||||||||||| || ||||| | |||||||| ||||| || || ||||||||||
Sbjct: 728 tggcacgagggctttggagactgtgctgtcatccaaaaccaaattgctgtcttgaagg 671
>emb|X59995.1|PTGWIN62B P.trichocarpa chitinase gene gwin6.2b, chiX pseudogene and gwin6.2c
gene 5'-region
Length = 7305
Score = 44.1 bits (22), Expect = 0.009
Identities = 52/62 (83%)
Strand = Plus / Minus
Query: 560 gcgtggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaag 619
||||| || |||||||| || ||||| || |||||||| ||||||| || |||||||||
Sbjct: 1611 gcgtgacaagagggctttggggactgtggtgtcatccaaaaccagagtgctgtcttgaag 1552
Query: 620 gc 621
||
Sbjct: 1551 gc 1550
>gb|DN485029.1|DN485029 M101D01.3pR Populus female catkins cDNA library Populus trichocarpa
cDNA clone M101D01 3', mRNA sequence
Length = 727
Score = 40.1 bits (20), Expect = 0.14
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 372 ccactccgagcataccgcagtacctcttgtag 403
|||||||||| ||| | |||||||||||||||
Sbjct: 67 ccactccgagtatatcacagtacctcttgtag 98
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 66,539
Number of Sequences: 369679
Number of extensions: 66539
Number of successful extensions: 17775
Number of sequences better than 0.5: 26
Number of HSP's better than 0.5 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17721
Number of HSP's gapped (non-prelim): 54
length of query: 908
length of database: 203,408,664
effective HSP length: 19
effective length of query: 889
effective length of database: 196,384,763
effective search space: 174586054307
effective search space used: 174586054307
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)