BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.211
(777 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DN485767.1|DN485767 N032D05.3pR Populus bark cDNA librar... 92 4e-017
gb|CX177737.1|CX177737 D06_45-46_08.ab1 leaf inoculated wit... 84 9e-015
gb|CX187099.1|CX187099 A01_45-10_01.ab1 leaf inoculated wit... 84 9e-015
gb|CV269279.1|CV269279 WS0207.B21_N04 PTxN-IB-N-A-11 Populu... 82 4e-014
gb|CX178440.1|CX178440 H11_45-123_15.ab1 leaf inoculated wi... 82 4e-014
gb|CA925852.1|CA925852 MTU7TL.P6.G03 Aspen leaf cDNA Librar... 80 1e-013
gb|DT516420.1|DT516420 WS02431.B21_F06 PTxD-ICC-N-A-14 Popu... 80 1e-013
gb|BU814728.1|BU814728 N032D05 Populus bark cDNA library Po... 78 6e-013
gb|BI121421.1|BI121421 F036P51Y Populus flower cDNA library... 74 9e-012
gb|CN522667.1|CN522667 GQ0124.B3_M12 GQ012 Populus trichoca... 74 9e-012
gb|CN522973.1|CN522973 GQ0122.B3_D24 GQ012 Populus trichoca... 74 9e-012
gb|CV229934.1|CV229934 WS01914.B21_O15 PT-DX-N-A-10 Populus... 74 9e-012
gb|CV234273.1|CV234273 WS01214.B21_F02 PT-GT-FL-A-3 Populus... 74 9e-012
gb|CV234291.1|CV234291 WS01214.B21_G06 PT-GT-FL-A-3 Populus... 74 9e-012
gb|CV242497.1|CV242497 WS02515.B21_D15 PT-MB-N-A-15 Populus... 74 9e-012
gb|CV248041.1|CV248041 WS0112.B21_D09 PT-P-FL-A-2 Populus t... 74 9e-012
gb|CV248261.1|CV248261 WS01120.B21_A12 PT-P-FL-A-2 Populus ... 74 9e-012
gb|CV248670.1|CV248670 WS01121.B21_I18 PT-P-FL-A-2 Populus ... 74 9e-012
gb|CV250552.1|CV250552 WS0113.B21_P01 PT-P-FL-A-2 Populus t... 74 9e-012
gb|CV253190.1|CV253190 WS0221.B21_C12 PTxD-ICC-A-12 Populus... 74 9e-012
gb|CV253860.1|CV253860 WS0223.B21_E05 PTxD-ICC-A-12 Populus... 74 9e-012
gb|CV253861.1|CV253861 WS0223.B21_E06 PTxD-ICC-A-12 Populus... 74 9e-012
gb|CV266235.1|CV266235 WS02029.B21_H11 PTxN-IB-N-A-11 Popul... 74 9e-012
gb|DT471589.1|DT471589 WS01214.BR_G06 PT-GT-FL-A-3 Populus ... 74 9e-012
gb|DT473900.1|DT473900 WS01230.BR_B13 PT-GT-FL-A-3 Populus ... 74 9e-012
gb|DT476580.1|DT476580 WS01230.B21_B13 PT-GT-FL-A-3 Populus... 74 9e-012
gb|DT482020.1|DT482020 WS02533.BR_K09 PT-MB-N-A-15 Populus ... 74 9e-012
gb|DT495045.1|DT495045 WS0112.BR_D09 PT-P-FL-A-2 Populus tr... 74 9e-012
gb|DT495288.1|DT495288 WS01120.BR_A12 PT-P-FL-A-2 Populus t... 74 9e-012
gb|DT495808.1|DT495808 WS01121.BR_I18 PT-P-FL-A-2 Populus t... 74 9e-012
gb|DT497948.1|DT497948 WS0113.BR_P01 PT-P-FL-A-2 Populus tr... 74 9e-012
gb|CA924860.1|CA924860 MTU7TL.P10.E07 Aspen leaf cDNA Libra... 72 3e-011
gb|CA925209.1|CA925209 MTU7TL.P15.A06 Aspen leaf cDNA Libra... 72 3e-011
gb|CK318056.1|CK318056 B9P04h09 Populus stem seasonal libra... 72 3e-011
gb|CV280230.1|CV280230 WS0135.B21_H07 PTxD-IL-FL-A-4 Populu... 72 3e-011
gb|CX172185.1|CX172185 G11_69-14-1_13.ab1 leaf inoculated w... 72 3e-011
gb|DT503098.1|DT503098 WS0135.BR_H07 PTxD-IL-FL-A-4 Populus... 72 3e-011
gb|DN495281.1|DN495281 N032D05.5pR Populus bark cDNA librar... 68 5e-010
gb|DT471569.1|DT471569 WS01214.BR_F02 PT-GT-FL-A-3 Populus ... 68 5e-010
gb|CF229833.1|CF229833 PtaxmjxtD11D1107 Poplar cDNA library... 66 2e-009
gb|AI162042.1|AI162042 A011P36U Hybrid aspen plasmid librar... 64 8e-009
gb|BI122268.1|BI122268 I004P48P Populus leaf cDNA library P... 64 8e-009
gb|BI128737.1|BI128737 G080P69Y Populus cambium cDNA librar... 64 8e-009
gb|BI129027.1|BI129027 G084P91Y Populus cambium cDNA librar... 64 8e-009
gb|BI131112.1|BI131112 G115P54Y Populus cambium cDNA librar... 64 8e-009
gb|BI138539.1|BI138539 F108P76Y Populus flower cDNA library... 64 8e-009
gb|BU809056.1|BU809056 UL53B04 Populus leaf cDNA library Po... 64 8e-009
gb|BU815977.1|BU815977 N058E08 Populus bark cDNA library Po... 64 8e-009
gb|BU831303.1|BU831303 T020A01 Populus apical shoot cDNA li... 64 8e-009
gb|BU831635.1|BU831635 T024A01 Populus apical shoot cDNA li... 64 8e-009
gb|BU833366.1|BU833366 T047B03 Populus apical shoot cDNA li... 64 8e-009
gb|BU835036.1|BU835036 T068G05 Populus apical shoot cDNA li... 64 8e-009
gb|BU835316.1|BU835316 T072D06 Populus apical shoot cDNA li... 64 8e-009
gb|BU838020.1|BU838020 T108F03 Populus apical shoot cDNA li... 64 8e-009
gb|BU866830.1|BU866830 S071C04 Populus imbibed seed cDNA li... 64 8e-009
gb|BU870348.1|BU870348 Q011D07 Populus flower cDNA library ... 64 8e-009
gb|BU870907.1|BU870907 Q019G06 Populus flower cDNA library ... 64 8e-009
gb|BU871955.1|BU871955 Q037B09 Populus flower cDNA library ... 64 8e-009
gb|BU874483.1|BU874483 Q068E11 Populus flower cDNA library ... 64 8e-009
gb|BU884995.1|BU884995 R019B06 Populus root cDNA library Po... 64 8e-009
gb|BU889171.1|BU889171 P017E11 Populus petioles cDNA librar... 64 8e-009
gb|BU890848.1|BU890848 P042E08 Populus petioles cDNA librar... 64 8e-009
gb|BU891136.1|BU891136 P046D10 Populus petioles cDNA librar... 64 8e-009
gb|BU894835.1|BU894835 X015G06 Populus wood cDNA library Po... 64 8e-009
gb|BU895982.1|BU895982 X033H02 Populus wood cDNA library Po... 64 8e-009
gb|CA934168.1|CA934168 MTU3TS.P4.A07 Aspen stem cDNA Librar... 64 8e-009
gb|CA821352.1|CA821352 RSH01G08 two-month-old roots from cl... 64 8e-009
gb|CF229827.1|CF229827 PtaxmjxtC5C0505 Poplar cDNA library ... 64 8e-009
gb|CF233685.1|CF233685 PtaJXO0026E10E1010 Poplar cDNA libra... 64 8e-009
gb|CF234473.1|CF234473 Ptajxojxo3A5A0501 Poplar cDNA librar... 64 8e-009
gb|CF234696.1|CF234696 PtaJXT0014A8A0802 Poplar cDNA librar... 64 8e-009
gb|CF234901.1|CF234901 PtaJXT0016E1E0109 Poplar cDNA librar... 64 8e-009
gb|CF235165.1|CF235165 PtaJXT0019F12F1212 Poplar cDNA libra... 64 8e-009
gb|CF235966.1|CF235966 PtaJXT0029A9A0901 Poplar cDNA librar... 64 8e-009
gb|CK098081.1|CK098081 A003P74.5pR Hybrid aspen plasmid lib... 64 8e-009
gb|CK098320.1|CK098320 A011P36.5pR Hybrid aspen plasmid lib... 64 8e-009
gb|CK101285.1|CK101285 F036P51.5pR Populus flower cDNA libr... 64 8e-009
gb|CK116359.1|CK116359 B010P56 Hybrid aspen plasmid library... 64 8e-009
gb|CK117293.1|CK117293 B031P71 Hybrid aspen plasmid library... 64 8e-009
gb|CN518679.1|CN518679 GQ0101.B3_K05 GQ010 Populus trichoca... 64 8e-009
gb|CK317972.1|CK317972 B9P03h10 Populus stem seasonal libra... 64 8e-009
gb|CV227436.1|CV227436 WS0167.B21_D01 PT-DX-A-7 Populus tri... 64 8e-009
gb|CV231323.1|CV231323 WS0194.B21_D05 PT-DX-N-A-10 Populus ... 64 8e-009
gb|CV247235.1|CV247235 WS01117.B21_H18 PT-P-FL-A-2 Populus ... 64 8e-009
gb|CV248429.1|CV248429 WS01120.B21_L13 PT-P-FL-A-2 Populus ... 64 8e-009
gb|CV249742.1|CV249742 WS01125.B21_C14 PT-P-FL-A-2 Populus ... 64 8e-009
gb|CV251064.1|CV251064 WS0115.B21_L20 PT-P-FL-A-2 Populus t... 64 8e-009
gb|CV251428.1|CV251428 WS0116.B21_P16 PT-P-FL-A-2 Populus t... 64 8e-009
gb|CV251655.1|CV251655 WS0117.B21_N13 PT-P-FL-A-2 Populus t... 64 8e-009
gb|CV259109.1|CV259109 WS02010.B21_G11 PTxN-IB-N-A-11 Popul... 64 8e-009
gb|CX175193.1|CX175193 H03_69-5_15.ab1 leaf inoculated with... 64 8e-009
gb|CX181444.1|CX181444 H03_45-4_15.ab1 leaf inoculated with... 64 8e-009
gb|CX183862.1|CX183862 B07_45-63_03.ab1 leaf inoculated wit... 64 8e-009
gb|DT477247.1|DT477247 WS02519.BR_G13 PT-MB-N-A-15 Populus ... 64 8e-009
gb|DT478666.1|DT478666 WS02523.BR_H08 PT-MB-N-A-15 Populus ... 64 8e-009
gb|DT482284.1|DT482284 WS02519.B21_G13 PT-MB-N-A-15 Populus... 64 8e-009
gb|DT483742.1|DT483742 WS02523.B21_H08 PT-MB-N-A-15 Populus... 64 8e-009
gb|DT487525.1|DT487525 WS02533.B21_O24 PT-MB-N-A-15 Populus... 64 8e-009
gb|DT494122.1|DT494122 WS01117.BR_H18 PT-P-FL-A-2 Populus t... 64 8e-009
gb|DT495522.1|DT495522 WS01120.BR_L13 PT-P-FL-A-2 Populus t... 64 8e-009
gb|DT498573.1|DT498573 WS0115.BR_L20 PT-P-FL-A-2 Populus tr... 64 8e-009
gb|DT499005.1|DT499005 WS0116.BR_P16 PT-P-FL-A-2 Populus tr... 64 8e-009
gb|DT506058.1|DT506058 WS01812.C21_J08 PTxD-IL-N-A-9 Populu... 64 8e-009
gb|DT522015.1|DT522015 WS02035.B21_N06 PTxN-IB-N-A-11 Popul... 64 8e-009
gb|DV466576.1|DV466576 MTUNUL1.P7.E01 NUL Populus fremontii... 64 8e-009
gb|BI123958.1|BI123958 I032P20P Populus leaf cDNA library P... 62 3e-008
gb|BU825330.1|BU825330 UK107TF05 Populus apical shoot cDNA ... 62 3e-008
gb|BU825508.1|BU825508 UK109TF04 Populus apical shoot cDNA ... 62 3e-008
gb|BU830229.1|BU830229 T005E11 Populus apical shoot cDNA li... 62 3e-008
gb|BU830419.1|BU830419 T008B01 Populus apical shoot cDNA li... 62 3e-008
gb|BU830920.1|BU830920 T014G09 Populus apical shoot cDNA li... 62 3e-008
gb|BU831442.1|BU831442 T021E09 Populus apical shoot cDNA li... 62 3e-008
gb|BU831589.1|BU831589 T023D05 Populus apical shoot cDNA li... 62 3e-008
gb|BU832818.1|BU832818 T038E12 Populus apical shoot cDNA li... 62 3e-008
gb|BU835476.1|BU835476 T074D07 Populus apical shoot cDNA li... 62 3e-008
gb|BU836781.1|BU836781 T090G10 Populus apical shoot cDNA li... 62 3e-008
gb|BU836918.1|BU836918 T092E05 Populus apical shoot cDNA li... 62 3e-008
gb|BU837317.1|BU837317 T097D07 Populus apical shoot cDNA li... 62 3e-008
gb|BU863581.1|BU863581 S029G11 Populus imbibed seed cDNA li... 62 3e-008
gb|BU892995.1|BU892995 P072A05 Populus petioles cDNA librar... 62 3e-008
gb|CF227550.1|CF227550 PtaXM0001D10D1008 Poplar cDNA librar... 62 3e-008
gb|CK093919.1|CK093919 I004P48.3pR Populus senescing leaves... 62 3e-008
gb|CN522736.1|CN522736 GQ0124.B3_D01 GQ012 Populus trichoca... 62 3e-008
gb|CV276032.1|CV276032 WS0178.B21.1_G15 PTxD-NR-A-8 Populus... 62 3e-008
gb|CF936997.1|CF936997 PO3014A03 Populus tomentiglandulosa ... 62 3e-008
gb|CX174857.1|CX174857 D11_69-83_07.ab1 leaf inoculated wit... 62 3e-008
gb|CX653586.1|CX653586 PO02004B08 Poplar SC cDNA library Po... 62 3e-008
gb|CX655046.1|CX655046 PO01004B09 Poplar SC cDNA library Po... 62 3e-008
gb|CX657913.1|CX657913 PO01006H08 Poplar SC cDNA library Po... 62 3e-008
gb|CX659598.1|CX659598 PO01032F06 Poplar SC cDNA library Po... 62 3e-008
gb|CX659603.1|CX659603 PO01032F11 Poplar SC cDNA library Po... 62 3e-008
gb|BI136840.1|BI136840 F075P10Y Populus flower cDNA library... 60 1e-007
gb|BI137256.1|BI137256 F083P08Y Populus flower cDNA library... 60 1e-007
gb|BU828161.1|BU828161 K017P61P Populus apical shoot cDNA l... 60 1e-007
gb|BU831408.1|BU831408 T021B04 Populus apical shoot cDNA li... 60 1e-007
gb|BU832177.1|BU832177 T030D02 Populus apical shoot cDNA li... 60 1e-007
gb|BU895222.1|BU895222 X020H06 Populus wood cDNA library Po... 60 1e-007
gb|BU895372.1|BU895372 X023B09 Populus wood cDNA library Po... 60 1e-007
gb|CA926679.1|CA926679 MTU6CR.P17.H06 Aspen root cDNA Libra... 60 1e-007
gb|CF233656.1|CF233656 PtaJXO0026B2B0204 Poplar cDNA librar... 60 1e-007
gb|CK091324.1|CK091324 F075P87.3pR Populus flower cDNA libr... 60 1e-007
gb|CV239461.1|CV239461 WS0232.B21_I03 PT-MB-A-13 Populus tr... 60 1e-007
gb|CV241149.1|CV241149 WS02511.B21_F16 PT-MB-N-A-15 Populus... 60 1e-007
gb|CV249837.1|CV249837 WS01125.B21_H14 PT-P-FL-A-2 Populus ... 60 1e-007
gb|CV250640.1|CV250640 WS0114.B21_E06 PT-P-FL-A-2 Populus t... 60 1e-007
gb|CV253489.1|CV253489 WS0222.B21_B17 PTxD-ICC-A-12 Populus... 60 1e-007
gb|CV270092.1|CV270092 WS0151.B21_B02 PTxN-IB-A-6 Populus t... 60 1e-007
gb|CV273228.1|CV273228 WS01710.B21_B17 PTxD-NR-A-8 Populus ... 60 1e-007
gb|CV274107.1|CV274107 WS0172.B21_D15 PTxD-NR-A-8 Populus t... 60 1e-007
gb|DT471078.1|DT471078 WS01212.BR_B18 PT-GT-FL-A-3 Populus ... 60 1e-007
gb|DT497095.1|DT497095 WS01125.BR_H14 PT-P-FL-A-2 Populus t... 60 1e-007
gb|DT498060.1|DT498060 WS0114.BR_E06 PT-P-FL-A-2 Populus tr... 60 1e-007
gb|DT523054.1|DT523054 WS02038.B21_K14 PTxN-IB-N-A-11 Popul... 60 1e-007
gb|DT523537.1|DT523537 WS02039.B21_P09 PTxN-IB-N-A-11 Popul... 60 1e-007
gb|BI120215.1|BI120215 F012P02Y Populus flower cDNA library... 58 5e-007
gb|BI121388.1|BI121388 F035P71Y Populus flower cDNA library... 58 5e-007
gb|BI139196.1|BI139196 F126P17Y Populus flower cDNA library... 58 5e-007
gb|BU819170.1|BU819170 UA40BPC05 Populus tremula cambium cD... 58 5e-007
gb|BU824267.1|BU824267 UB62BPD02 Populus tremula cambium cD... 58 5e-007
gb|BU824904.1|BU824904 UK101TC05 Populus apical shoot cDNA ... 58 5e-007
gb|BU827620.1|BU827620 K005P93P Populus apical shoot cDNA l... 58 5e-007
gb|BU830934.1|BU830934 T015A05 Populus apical shoot cDNA li... 58 5e-007
gb|BU833718.1|BU833718 T051F07 Populus apical shoot cDNA li... 58 5e-007
gb|BU833719.1|BU833719 T051F08 Populus apical shoot cDNA li... 58 5e-007
gb|BU834081.1|BU834081 T056E01 Populus apical shoot cDNA li... 58 5e-007
gb|BU834769.1|BU834769 T065E02 Populus apical shoot cDNA li... 58 5e-007
gb|BU835869.1|BU835869 T079F09 Populus apical shoot cDNA li... 58 5e-007
gb|BU836005.1|BU836005 T081E05 Populus apical shoot cDNA li... 58 5e-007
gb|BU837006.1|BU837006 T093E10 Populus apical shoot cDNA li... 58 5e-007
gb|BU837884.1|BU837884 T106G04 Populus apical shoot cDNA li... 58 5e-007
gb|BU866047.1|BU866047 S062A11 Populus imbibed seed cDNA li... 58 5e-007
gb|BU871295.1|BU871295 Q029A05 Populus flower cDNA library ... 58 5e-007
gb|BU874126.1|BU874126 Q064F01 Populus flower cDNA library ... 58 5e-007
gb|BU881685.1|BU881685 UM66TB09 Populus flower cDNA library... 58 5e-007
gb|BU882157.1|BU882157 UM73TD04 Populus flower cDNA library... 58 5e-007
gb|BU893140.1|BU893140 P073G11 Populus petioles cDNA librar... 58 5e-007
gb|BU893861.1|BU893861 P083F11 Populus petioles cDNA librar... 58 5e-007
gb|BU893938.1|BU893938 P084F11 Populus petioles cDNA librar... 58 5e-007
gb|CA821318.1|CA821318 RSH01D06 two-month-old roots from cl... 58 5e-007
gb|CF230332.1|CF230332 PtaC0007A11A1101 Poplar cDNA library... 58 5e-007
gb|CF236126.1|CF236126 PtaJXT0030H6H0616 Poplar cDNA librar... 58 5e-007
gb|CK090685.1|CK090685 F018P79.3pR Populus flower cDNA libr... 58 5e-007
gb|CK101065.1|CK101065 F018P79.5pR Populus flower cDNA libr... 58 5e-007
gb|CK101208.1|CK101208 F030P20.5pR Populus flower cDNA libr... 58 5e-007
gb|CK101506.1|CK101506 F075P87.5pR Populus flower cDNA libr... 58 5e-007
gb|CN522862.1|CN522862 GQ0122.B3_M18 GQ012 Populus trichoca... 58 5e-007
gb|CN549560.1|CN549560 GQ0243.B3_F18 GQ024 Populus trichoca... 58 5e-007
gb|AJ768710.1|AJ768710 AJ768710 Populus euphratica leaf adu... 58 5e-007
gb|CV233507.1|CV233507 WS01211.B21_E06 PT-GT-FL-A-3 Populus... 58 5e-007
gb|CV234893.1|CV234893 WS01216.B21_M18 PT-GT-FL-A-3 Populus... 58 5e-007
gb|CV236999.1|CV236999 WS01226.B21.1_E01 PT-GT-FL-A-3 Popul... 58 5e-007
gb|CV237686.1|CV237686 WS0123.B21_L12 PT-GT-FL-A-3 Populus ... 58 5e-007
gb|CV238990.1|CV238990 WS0128.B21.1_P15 PT-GT-FL-A-3 Populu... 58 5e-007
gb|CV240095.1|CV240095 WS0234.B21_G04 PT-MB-A-13 Populus tr... 58 5e-007
gb|CV247045.1|CV247045 WS01116.B21_N08 PT-P-FL-A-2 Populus ... 58 5e-007
gb|CV248299.1|CV248299 WS01120.B21_D01 PT-P-FL-A-2 Populus ... 58 5e-007
gb|CV248734.1|CV248734 WS01121.B21_M06 PT-P-FL-A-2 Populus ... 58 5e-007
gb|CV251510.1|CV251510 WS0117.B21_E16 PT-P-FL-A-2 Populus t... 58 5e-007
gb|CV253026.1|CV253026 PX0019.B21.1_O14 PT-X-FL-A-1 Populus... 58 5e-007
gb|CV253048.1|CV253048 PX0019.B21.1_P19 PT-X-FL-A-1 Populus... 58 5e-007
gb|CV255772.1|CV255772 WS0242.B21_A06 PTxD-ICC-N-A-14 Popul... 58 5e-007
gb|CV267328.1|CV267328 WS02031.B21_H07 PTxN-IB-N-A-11 Popul... 58 5e-007
gb|CV267604.1|CV267604 WS02032.B21_D07 PTxN-IB-N-A-11 Popul... 58 5e-007
gb|CV268247.1|CV268247 WS0204.B21_P10 PTxN-IB-N-A-11 Populu... 58 5e-007
gb|CV274360.1|CV274360 WS0173.B21_A09 PTxD-NR-A-8 Populus t... 58 5e-007
gb|DN492045.1|DN492045 V042F02.3pR Populus male catkins cDN... 58 5e-007
gb|DN501989.1|DN501989 V042F02.5pR Populus male catkins cDN... 58 5e-007
gb|DT470858.1|DT470858 WS01211.BR_E06 PT-GT-FL-A-3 Populus ... 58 5e-007
gb|DT472526.1|DT472526 WS01226.BR_E01 PT-GT-FL-A-3 Populus ... 58 5e-007
gb|DT473397.1|DT473397 WS01229.BR_I14 PT-GT-FL-A-3 Populus ... 58 5e-007
gb|DT473781.1|DT473781 WS0123.BR_L12 PT-GT-FL-A-3 Populus t... 58 5e-007
gb|DT476011.1|DT476011 WS0128.BR_P15 PT-GT-FL-A-3 Populus t... 58 5e-007
gb|DT476419.1|DT476419 WS01229.B21_I14 PT-GT-FL-A-3 Populus... 58 5e-007
gb|DT489949.1|DT489949 WS02543.B21_K02 PT-MB-N-A-15 Populus... 58 5e-007
gb|DT495342.1|DT495342 WS01120.BR_D01 PT-P-FL-A-2 Populus t... 58 5e-007
gb|DT495882.1|DT495882 WS01121.BR_M06 PT-P-FL-A-2 Populus t... 58 5e-007
gb|DT499098.1|DT499098 WS0117.BR_E16 PT-P-FL-A-2 Populus tr... 58 5e-007
gb|DT500942.1|DT500942 PX0019.BR_O14 PT-X-FL-A-1 Populus tr... 58 5e-007
gb|DT500965.1|DT500965 PX0019.BR_P19 PT-X-FL-A-1 Populus tr... 58 5e-007
gb|DT505430.1|DT505430 WS01810.C21_O12 PTxD-IL-N-A-9 Populu... 58 5e-007
gb|DT506313.1|DT506313 WS0189.C21_E02 PTxD-IL-N-A-9 Populus... 58 5e-007
gb|DT516534.1|DT516534 WS02431.B21_L03 PTxD-ICC-N-A-14 Popu... 58 5e-007
gb|DT525135.1|DT525135 WS02044.C21_I16 PTxN-IB-N-A-11 Popul... 58 5e-007
gb|BI136309.1|BI136309 F066P43Y Populus flower cDNA library... 56 2e-006
gb|BU823190.1|BU823190 UB49DPB02 Populus tremula cambium cD... 56 2e-006
gb|BU833244.1|BU833244 T044B03 Populus apical shoot cDNA li... 56 2e-006
gb|BU871846.1|BU871846 Q035C01 Populus flower cDNA library ... 56 2e-006
gb|CF231370.1|CF231370 PtaC0020F4F0412 Poplar cDNA library ... 56 2e-006
gb|AJ775059.1|AJ775059 AJ775059 Populus euphratica shoot 3-... 56 2e-006
gb|CV271893.1|CV271893 WS0155.B21_P15 PTxN-IB-A-6 Populus t... 56 2e-006
gb|DT499078.1|DT499078 WS0117.BR_D18 PT-P-FL-A-2 Populus tr... 56 2e-006
gb|AI164521.1|AI164521 A064P63U Hybrid aspen plasmid librar... 54 8e-006
gb|AI164817.1|AI164817 A069p23u Hybrid aspen plasmid librar... 54 8e-006
gb|AI164965.1|AI164965 A071P56U Hybrid aspen plasmid librar... 54 8e-006
gb|AI165240.1|AI165240 A079P33U Hybrid aspen plasmid librar... 54 8e-006
gb|BI119788.1|BI119788 F005P25Y Populus flower cDNA library... 54 8e-006
gb|BI122006.1|BI122006 F051P32Y Populus flower cDNA library... 54 8e-006
gb|BI124917.1|BI124917 I052P91P Populus leaf cDNA library P... 54 8e-006
gb|BI138462.1|BI138462 F106P92Y Populus flower cDNA library... 54 8e-006
gb|BI138790.1|BI138790 F115P85Y Populus flower cDNA library... 54 8e-006
gb|BU813087.1|BU813087 N005A11 Populus bark cDNA library Po... 54 8e-006
gb|BU813717.1|BU813717 N014C04 Populus bark cDNA library Po... 54 8e-006
gb|BU823736.1|BU823736 UB55BPH12 Populus tremula cambium cD... 54 8e-006
gb|BU825653.1|BU825653 UK111TE03 Populus apical shoot cDNA ... 54 8e-006
gb|BU825935.1|BU825935 UK114TG09 Populus apical shoot cDNA ... 54 8e-006
gb|BU825998.1|BU825998 UK115TE04 Populus apical shoot cDNA ... 54 8e-006
gb|BU826391.1|BU826391 UK120TB02 Populus apical shoot cDNA ... 54 8e-006
gb|BU826550.1|BU826550 UK121TH11 Populus apical shoot cDNA ... 54 8e-006
gb|BU826963.1|BU826963 UK126TH05 Populus apical shoot cDNA ... 54 8e-006
gb|BU827303.1|BU827303 UK131TA07 Populus apical shoot cDNA ... 54 8e-006
gb|BU827840.1|BU827840 K009P91P Populus apical shoot cDNA l... 54 8e-006
gb|BU828006.1|BU828006 K014P48P Populus apical shoot cDNA l... 54 8e-006
gb|BU828365.1|BU828365 K021P73P Populus apical shoot cDNA l... 54 8e-006
gb|BU828524.1|BU828524 K024P62P Populus apical shoot cDNA l... 54 8e-006
gb|BU828572.1|BU828572 K025P27P Populus apical shoot cDNA l... 54 8e-006
gb|BU829293.1|BU829293 K037P92P Populus apical shoot cDNA l... 54 8e-006
gb|BU829382.1|BU829382 K039P68P Populus apical shoot cDNA l... 54 8e-006
gb|BU829824.1|BU829824 K068P43P Populus apical shoot cDNA l... 54 8e-006
gb|BU829877.1|BU829877 T001B09 Populus apical shoot cDNA li... 54 8e-006
gb|BU830563.1|BU830563 T010B02 Populus apical shoot cDNA li... 54 8e-006
gb|BU830689.1|BU830689 T011F07 Populus apical shoot cDNA li... 54 8e-006
gb|BU832476.1|BU832476 T034C11 Populus apical shoot cDNA li... 54 8e-006
gb|BU832689.1|BU832689 T037B04 Populus apical shoot cDNA li... 54 8e-006
gb|BU832903.1|BU832903 T039F01 Populus apical shoot cDNA li... 54 8e-006
gb|BU832959.1|BU832959 T042A06 Populus apical shoot cDNA li... 54 8e-006
gb|BU833260.1|BU833260 T044C12 Populus apical shoot cDNA li... 54 8e-006
gb|BU833305.1|BU833305 T044H06 Populus apical shoot cDNA li... 54 8e-006
gb|BU833306.1|BU833306 T044H07 Populus apical shoot cDNA li... 54 8e-006
gb|BU833555.1|BU833555 T049F02 Populus apical shoot cDNA li... 54 8e-006
gb|BU833732.1|BU833732 T051G11 Populus apical shoot cDNA li... 54 8e-006
gb|BU834178.1|BU834178 T057H05 Populus apical shoot cDNA li... 54 8e-006
gb|BU834248.1|BU834248 T058G07 Populus apical shoot cDNA li... 54 8e-006
gb|BU834289.1|BU834289 T059C06 Populus apical shoot cDNA li... 54 8e-006
gb|BU834595.1|BU834595 T063D01 Populus apical shoot cDNA li... 54 8e-006
gb|BU834835.1|BU834835 T066C10 Populus apical shoot cDNA li... 54 8e-006
gb|BU835164.1|BU835164 T070D09 Populus apical shoot cDNA li... 54 8e-006
gb|BU835175.1|BU835175 T070E08 Populus apical shoot cDNA li... 54 8e-006
gb|BU835819.1|BU835819 T079A11 Populus apical shoot cDNA li... 54 8e-006
gb|BU836009.1|BU836009 T081E10 Populus apical shoot cDNA li... 54 8e-006
gb|BU836145.1|BU836145 T083B11 Populus apical shoot cDNA li... 54 8e-006
gb|BU836149.1|BU836149 T083C03 Populus apical shoot cDNA li... 54 8e-006
gb|BU836154.1|BU836154 T083C08 Populus apical shoot cDNA li... 54 8e-006
gb|BU836221.1|BU836221 T084A10 Populus apical shoot cDNA li... 54 8e-006
gb|BU836354.1|BU836354 T085F02 Populus apical shoot cDNA li... 54 8e-006
gb|BU836384.1|BU836384 T086A01 Populus apical shoot cDNA li... 54 8e-006
gb|BU836568.1|BU836568 T088B10 Populus apical shoot cDNA li... 54 8e-006
gb|BU836726.1|BU836726 T090B07 Populus apical shoot cDNA li... 54 8e-006
gb|BU836892.1|BU836892 T092B09 Populus apical shoot cDNA li... 54 8e-006
gb|BU837306.1|BU837306 T097C06 Populus apical shoot cDNA li... 54 8e-006
gb|BU837460.1|BU837460 T102A12 Populus apical shoot cDNA li... 54 8e-006
gb|BU837558.1|BU837558 T103B08 Populus apical shoot cDNA li... 54 8e-006
gb|BU837597.1|BU837597 T103F02 Populus apical shoot cDNA li... 54 8e-006
gb|BU837928.1|BU837928 T107C10 Populus apical shoot cDNA li... 54 8e-006
gb|BU862760.1|BU862760 S019F10 Populus imbibed seed cDNA li... 54 8e-006
gb|BU871880.1|BU871880 Q035F03 Populus flower cDNA library ... 54 8e-006
gb|BU872601.1|BU872601 Q044G10 Populus flower cDNA library ... 54 8e-006
gb|BU873795.1|BU873795 Q060A08 Populus flower cDNA library ... 54 8e-006
gb|BU873849.1|BU873849 Q060F04 Populus flower cDNA library ... 54 8e-006
gb|BU885275.1|BU885275 R028H02 Populus root cDNA library Po... 54 8e-006
gb|BU885450.1|BU885450 R031D08 Populus root cDNA library Po... 54 8e-006
gb|BU886587.1|BU886587 R047G08 Populus root cDNA library Po... 54 8e-006
gb|BU892903.1|BU892903 P070H08 Populus petioles cDNA librar... 54 8e-006
gb|BU894723.1|BU894723 X013H03 Populus wood cDNA library Po... 54 8e-006
gb|BU898146.1|BU898146 X075E08 Populus wood cDNA library Po... 54 8e-006
gb|CA923441.1|CA923441 MTU7CL.P10.E05 Aspen leaf cDNA Libra... 54 8e-006
gb|CA923518.1|CA923518 MTU7CL.P11.E02 Aspen leaf cDNA Libra... 54 8e-006
gb|CA923535.1|CA923535 MTU7CL.P11.F10 Aspen leaf cDNA Libra... 54 8e-006
gb|CA924999.1|CA924999 MTU7TL.P12.D06 Aspen leaf cDNA Libra... 54 8e-006
gb|CA925622.1|CA925622 MTU7TL.P3.H04 Aspen leaf cDNA Librar... 54 8e-006
gb|CA822204.1|CA822204 R05A01 two-month-old roots from clon... 54 8e-006
gb|CA822846.1|CA822846 R14F06 two-month-old roots from clon... 54 8e-006
gb|CA824181.1|CA824181 R37G03 two-month-old roots from clon... 54 8e-006
gb|CF228594.1|CF228594 PtaXM0015A4A0402 Poplar cDNA library... 54 8e-006
gb|CF229729.1|CF229729 PtaXM0028H4H0416 Poplar cDNA library... 54 8e-006
gb|CK091544.1|CK091544 F106P92.3pR Populus flower cDNA libr... 54 8e-006
gb|CK101660.1|CK101660 F106P92.5pR Populus flower cDNA libr... 54 8e-006
gb|CK108249.1|CK108249 G129P17 Populus tension wood cDNA li... 54 8e-006
gb|CK109518.1|CK109518 N017G09 Populus bark cDNA library Po... 54 8e-006
gb|CV232224.1|CV232224 WS0196.B21_O21 PT-DX-N-A-10 Populus ... 54 8e-006
gb|CV233479.1|CV233479 WS01211.B21_B24 PT-GT-FL-A-3 Populus... 54 8e-006
gb|CV235554.1|CV235554 WS0122.B21_J14 PT-GT-FL-A-3 Populus ... 54 8e-006
gb|CV236425.1|CV236425 WS01224.B21.1_A22 PT-GT-FL-A-3 Popul... 54 8e-006
gb|CV236495.1|CV236495 WS01224.B21.1_F10 PT-GT-FL-A-3 Popul... 54 8e-006
gb|CV237913.1|CV237913 WS0124.B21_I23 PT-GT-FL-A-3 Populus ... 54 8e-006
gb|CV247315.1|CV247315 WS01117.B21_M07 PT-P-FL-A-2 Populus ... 54 8e-006
gb|CV250058.1|CV250058 WS01126.B21_D10 PT-P-FL-A-2 Populus ... 54 8e-006
gb|CV252171.1|CV252171 WS0119.B21_L08 PT-P-FL-A-2 Populus t... 54 8e-006
gb|CV260019.1|CV260019 WS02012.B21_O20 PTxN-IB-N-A-11 Popul... 54 8e-006
gb|CV280307.1|CV280307 WS0135.B21_M04 PTxD-IL-FL-A-4 Populu... 54 8e-006
gb|CF936592.1|CF936592 PO3007H08 Populus tomentiglandulosa ... 54 8e-006
gb|CF936896.1|CF936896 PO3011F11 Populus tomentiglandulosa ... 54 8e-006
gb|CX169163.1|CX169163 F02_69-49_12.ab1 leaf inoculated wit... 54 8e-006
gb|CX653513.1|CX653513 PO02003A10 Poplar SC cDNA library Po... 54 8e-006
gb|CX653829.1|CX653829 PO02007G11 Poplar SC cDNA library Po... 54 8e-006
gb|CX653881.1|CX653881 PO02008E04 Poplar SC cDNA library Po... 54 8e-006
gb|CX654699.1|CX654699 PO02058D03 Poplar SC cDNA library Po... 54 8e-006
gb|CX654812.1|CX654812 PO02060A01 Poplar SC cDNA library Po... 54 8e-006
gb|CX655595.1|CX655595 PO02037A08 Poplar SC cDNA library Po... 54 8e-006
gb|CX655724.1|CX655724 PO02039A09 Poplar SC cDNA library Po... 54 8e-006
gb|CX658457.1|CX658457 PO01035C08 Poplar SC cDNA library Po... 54 8e-006
gb|CX658489.1|CX658489 PO01035F08 Poplar SC cDNA library Po... 54 8e-006
gb|DN483584.1|DN483584 PSO201A01 Populus tomentiglandulosa ... 54 8e-006
gb|DT470821.1|DT470821 WS01211.BR_B24 PT-GT-FL-A-3 Populus ... 54 8e-006
gb|DT471949.1|DT471949 WS0122.BR_J14 PT-GT-FL-A-3 Populus t... 54 8e-006
gb|DT474650.1|DT474650 WS0124.BR_I23 PT-GT-FL-A-3 Populus t... 54 8e-006
gb|DT476588.1|DT476588 WS01230.B21_B24 PT-GT-FL-A-3 Populus... 54 8e-006
gb|DT494214.1|DT494214 WS01117.BR_M07 PT-P-FL-A-2 Populus t... 54 8e-006
gb|DT497350.1|DT497350 WS01126.BR_D10 PT-P-FL-A-2 Populus t... 54 8e-006
gb|DT499281.1|DT499281 WS0117.BR_N13 PT-P-FL-A-2 Populus tr... 54 8e-006
gb|DT503182.1|DT503182 WS0135.BR_M04 PTxD-IL-FL-A-4 Populus... 54 8e-006
gb|DT505744.1|DT505744 WS01811.C21_L22 PTxD-IL-N-A-9 Populu... 54 8e-006
gb|DT521332.1|DT521332 WS02034.B21_A04 PTxN-IB-N-A-11 Popul... 54 8e-006
gb|BU835487.1|BU835487 T074E08 Populus apical shoot cDNA li... 52 3e-005
gb|AJ773481.1|AJ773481 AJ773481 Populus euphratica shoot 3-... 52 3e-005
gb|AJ773482.1|AJ773482 AJ773482 Populus euphratica shoot 3-... 52 3e-005
gb|CX182993.1|CX182993 B03_45-77_03.ab1 leaf inoculated wit... 52 3e-005
gb|BI127025.1|BI127025 I084P95P Populus leaf cDNA library P... 50 1e-004
gb|BU833994.1|BU833994 T055C10 Populus apical shoot cDNA li... 50 1e-004
gb|BU834504.1|BU834504 T062A04 Populus apical shoot cDNA li... 50 1e-004
gb|BU835600.1|BU835600 T076A11 Populus apical shoot cDNA li... 50 1e-004
gb|BU835804.1|BU835804 T078H03 Populus apical shoot cDNA li... 50 1e-004
gb|BU869678.1|BU869678 Q003B04 Populus flower cDNA library ... 50 1e-004
gb|CK109247.1|CK109247 K055P94 Populus apical shoot cDNA li... 50 1e-004
gb|AJ773395.1|AJ773395 AJ773395 Populus euphratica shoot 3-... 50 1e-004
gb|AI166001.1|AI166001 B005p49u Hybrid aspen plasmid librar... 48 5e-004
gb|BI123387.1|BI123387 I022P57P Populus leaf cDNA library P... 48 5e-004
gb|CK117126.1|CK117126 B028P68 Hybrid aspen plasmid library... 48 5e-004
gb|DT508974.1|DT508974 WS02422.BR_H03 PTxD-ICC-N-A-14 Popul... 48 5e-004
gb|DT513582.1|DT513582 WS02422.B21_H03 PTxD-ICC-N-A-14 Popu... 48 5e-004
gb|BI124824.1|BI124824 I051P45P Populus leaf cDNA library P... 46 0.002
gb|BU827480.1|BU827480 K003P37P Populus apical shoot cDNA l... 46 0.002
gb|BU831471.1|BU831471 T021H08 Populus apical shoot cDNA li... 46 0.002
gb|BU837164.1|BU837164 T095E02 Populus apical shoot cDNA li... 46 0.002
gb|CF120241.1|CF120241 MTU8DD.P3.F05 Aspen leaf mRNA differ... 46 0.002
gb|CF120250.1|CF120250 MTU8DD.P3.G05 Aspen leaf mRNA differ... 46 0.002
gb|CF120251.1|CF120251 MTU8DD.P3.G06 Aspen leaf mRNA differ... 46 0.002
gb|CK114203.1|CK114203 V043F02 Populus male catkins cDNA li... 46 0.002
gb|BI125680.1|BI125680 I064P51P Populus leaf cDNA library P... 44 0.008
gb|BU832539.1|BU832539 T035B06 Populus apical shoot cDNA li... 44 0.008
gb|CF230756.1|CF230756 PtaC0012F4F0412 Poplar cDNA library ... 44 0.008
gb|BP926141.1|BP926141 BP926141 full-length enriched poplar... 44 0.008
gb|DT479855.1|DT479855 WS02527.BR_C20 PT-MB-N-A-15 Populus ... 44 0.008
gb|DT485058.1|DT485058 WS02527.B21_C20 PT-MB-N-A-15 Populus... 44 0.008
gb|DT488344.1|DT488344 WS02536.B21_C20 PT-MB-N-A-15 Populus... 44 0.008
gb|DT518803.1|DT518803 WS02439.B21_F04 PTxD-ICC-N-A-14 Popu... 44 0.008
gb|BU810566.1|BU810566 UL72PD12 Populus leaf cDNA library P... 42 0.031
gb|BU825529.1|BU825529 UK109TH02 Populus apical shoot cDNA ... 42 0.031
gb|BU825974.1|BU825974 UK115TC01 Populus apical shoot cDNA ... 42 0.031
gb|BU832971.1|BU832971 T042B10 Populus apical shoot cDNA li... 42 0.031
gb|BU833253.1|BU833253 T044C02 Populus apical shoot cDNA li... 42 0.031
gb|BU836497.1|BU836497 T087D01 Populus apical shoot cDNA li... 42 0.031
gb|BU836851.1|BU836851 T091F07 Populus apical shoot cDNA li... 42 0.031
gb|BU867079.1|BU867079 S074A12 Populus imbibed seed cDNA li... 42 0.031
gb|BU874015.1|BU874015 Q063D05 Populus flower cDNA library ... 42 0.031
gb|BU895211.1|BU895211 X020G06 Populus wood cDNA library Po... 42 0.031
gb|AI161612.1|AI161612 A003P74U Hybrid aspen plasmid librar... 40 0.12
gb|CA822582.1|CA822582 R10C01 two-month-old roots from clon... 40 0.12
gb|AJ776568.1|AJ776568 AJ776568 Populus euphratica root 3-6... 40 0.12
gb|AJ780489.1|AJ780489 AJ780489 Populus euphratica leaf 3-6... 40 0.12
gb|BP927396.1|BP927396 BP927396 full-length enriched poplar... 40 0.12
gb|DN500609.1|DN500609 UL68A06.5pR Populus cold stressed le... 40 0.12
gb|BI119884.1|BI119884 F006P71Y Populus flower cDNA library... 38 0.49
gb|BU828332.1|BU828332 K021P08P Populus apical shoot cDNA l... 38 0.49
gb|BU835315.1|BU835315 T072D05 Populus apical shoot cDNA li... 38 0.49
gb|CB239844.1|CB239844 RSH17E09 two-month-old roots from cl... 38 0.49
gb|CV245062.1|CV245062 WS0256.B21_G04 PT-MB-N-A-15 Populus ... 38 0.49
gb|CX182699.1|CX182699 G04_45-124_14.ab1 leaf inoculated wi... 38 0.49
gb|CX656749.1|CX656749 PO02023F05 Poplar SC cDNA library Po... 38 0.49
gb|DT484098.1|DT484098 WS02524.B21_H01 PT-MB-N-A-15 Populus... 38 0.49
gb|DT524462.1|DT524462 WS02042.C21.1_L13 PTxN-IB-N-A-11 Pop... 38 0.49
gb|DT525077.1|DT525077 WS02044.C21_G02 PTxN-IB-N-A-11 Popul... 38 0.49
>gb|DN485767.1|DN485767 N032D05.3pR Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA clone N032D05 3', mRNA sequence
Length = 458
Score = 91.7 bits (46), Expect = 4e-017
Identities = 100/118 (84%)
Strand = Plus / Plus
Query: 249 gaacttggtgacggctttggtgccctcggagacggcgtgcttggcgagctcgccggggag 308
|||||||||||| | ||||| || || |||| ||||||||||| ||||| ||||||||
Sbjct: 245 gaacttggtgaccgacttggtaccttccgagatggcgtgcttggaaagctcaccggggag 304
Query: 309 gacgaggcggacggaggtctggatctcgcgggacgtgatggtaggcttcttgttgtac 366
|| ||||||||| | |||||||||||| || |||| |||||| | |||||||||||||
Sbjct: 305 gatgaggcggacagcggtctggatctctcgcgacgagatggtcgacttcttgttgtac 362
>gb|CX177737.1|CX177737 D06_45-46_08.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 635
Score = 83.8 bits (42), Expect = 9e-015
Identities = 168/210 (80%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtaccgcgccagcttggccgcc 384
||||||||||| || || || |||||||||||||||||||||| || ||| | | | |
Sbjct: 402 gtctggatctcccgagaagtaatggtaggcttcttgttgtacctagcgagccttgaagac 343
Query: 385 tccgccgccagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 444
||| || |||||||| ||||| || |||||||| ||||||||| ||| ||||||
Sbjct: 342 tcctgagcaagcttctcaaagatatcattgatgaaactgttcatgatacccattgccttg 283
Query: 445 gacgagatgccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtac 504
||||| ||||| || ||||| ||||| |||| || ||||||||||||||||||||
Sbjct: 282 cttgagatcccaatatcagggtggacctgtttcaagactttgaagatgtagatcttgtag 223
Query: 505 gtctccaccgacttctttgccttcttcttc 534
||||| || |||||||||||||||||||
Sbjct: 222 gtctcaacgctcttctttgccttcttcttc 193
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 116 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 70
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 491 cctaagagctagtgaacttggtaacggc 464
>gb|CX187099.1|CX187099 A01_45-10_01.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 594
Score = 83.8 bits (42), Expect = 9e-015
Identities = 168/210 (80%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtaccgcgccagcttggccgcc 384
||||||||||| || || || |||||||||||||||||||||| || ||| | | | |
Sbjct: 402 gtctggatctcccgagaagtaatggtaggcttcttgttgtacctagcgagccttgaagac 343
Query: 385 tccgccgccagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttg 444
||| || |||||||| ||||| || |||||||| ||||||||| ||| ||||||
Sbjct: 342 tcctgagcaagcttctcaaagatatcattgatgaaactgttcatgatacccattgccttg 283
Query: 445 gacgagatgccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtac 504
||||| ||||| || ||||| ||||| |||| || ||||||||||||||||||||
Sbjct: 282 cttgagatcccaatatcagggtggacctgtttcaagactttgaagatgtagatcttgtag 223
Query: 505 gtctccaccgacttctttgccttcttcttc 534
||||| || |||||||||||||||||||
Sbjct: 222 gtctcaacgctcttctttgccttcttcttc 193
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 116 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 70
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 491 cctaagagctagtgaacttggtaacggc 464
>gb|CV269279.1|CV269279 WS0207.B21_N04 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS0207_N04 3', mRNA sequence
Length = 642
Score = 81.8 bits (41), Expect = 4e-014
Identities = 116/141 (82%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| ||||||
Sbjct: 311 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgctcgagatc 370
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| ||||||||||| ||||||||||| ||||| ||
Sbjct: 371 ccaatatcagggtgtacctgtttcaagaccttgaagatatagatcttgtaggtctcaacg 430
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 431 ctcttctttgccttcttcttc 451
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 528 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 574
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 242 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 284
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 153 cctaagagctagtgaacttggtaacggc 180
>gb|CX178440.1|CX178440 H11_45-123_15.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 621
Score = 81.8 bits (41), Expect = 4e-014
Identities = 116/141 (82%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 328 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 269
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||||||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 268 ccaatatcagggtgcacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 209
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 208 ctcttctttgccttcttcttc 188
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 397 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 355
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 111 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 65
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 486 cctaagagctagtgaacttggtaacggc 459
>gb|CA925852.1|CA925852 MTU7TL.P6.G03 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 424
Score = 79.8 bits (40), Expect = 1e-013
Identities = 76/88 (86%)
Strand = Plus / Plus
Query: 447 cgagatgccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgt 506
|||||| || ||||| ||||| ||||| |||| ||||||||||||||||||||||| ||
Sbjct: 229 cgagatcccgatgtcagggtgaacctgtttcaagaccttgaagatgtagatcttgtaggt 288
Query: 507 ctccaccgacttctttgccttcttcttc 534
||| || |||||||||||||||||||
Sbjct: 289 ctcgacgttcttctttgccttcttcttc 316
>gb|DT516420.1|DT516420 WS02431.B21_F06 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02431_F06 3', mRNA sequence
Length = 879
Score = 79.8 bits (40), Expect = 1e-013
Identities = 76/88 (86%)
Strand = Plus / Minus
Query: 447 cgagatgccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgt 506
|||||| || ||||| ||||| ||||| |||| ||||||||||||||||||||||| ||
Sbjct: 709 cgagatcccgatgtcagggtgaacctgtttcaagaccttgaagatgtagatcttgtaggt 650
Query: 507 ctccaccgacttctttgccttcttcttc 534
||| || |||||||||||||||||||
Sbjct: 649 ctcgacgctcttctttgccttcttcttc 622
>gb|BU814728.1|BU814728 N032D05 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 265
Score = 77.8 bits (39), Expect = 6e-013
Identities = 78/91 (85%)
Strand = Plus / Minus
Query: 277 gagacggcgtgcttggcgagctcgccggggaggacgaggcggacggaggtctggatctcg 336
|||| ||||||||||| ||||| |||||||| | ||||||||| | ||||||||||||
Sbjct: 97 gagatggcgtgcttggaaagctcaccggggagtatgaggcggacagcggtctggatctct 38
Query: 337 cgggacgtgatggtaggcttcttgttgtacc 367
|| |||| |||||| | ||||||||||||||
Sbjct: 37 cgcgacgagatggtcgacttcttgttgtacc 7
>gb|BI121421.1|BI121421 F036P51Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 319
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 318 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 259
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 258 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 199
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 198 ctcttctttgccttcttcttc 178
>gb|CN522667.1|CN522667 GQ0124.B3_M12 GQ012 Populus trichocarpa x Populus deltoides cDNA
clone GQ0124_M12 5', mRNA sequence
Length = 530
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 362 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 303
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 302 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 243
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 242 ctcttctttgccttcttcttc 222
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 431 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 389
Score = 50.1 bits (25), Expect = 1e-004
Identities = 43/49 (87%)
Strand = Plus / Minus
Query: 639 ctcggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
|||||| |||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 132 ctcggccggcttcttctcggccggcttcttctctgccttgggagccatt 84
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggcc 675
||||||||||||| |||| |||||||||||||||
Sbjct: 145 cggcaggcttcttctcggccggcttcttctcggcc 111
>gb|CN522973.1|CN522973 GQ0122.B3_D24 GQ012 Populus trichocarpa x Populus deltoides cDNA
clone GQ0122_D24 5', mRNA sequence
Length = 537
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 372 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 313
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 312 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 253
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 252 ctcttctttgccttcttcttc 232
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 441 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 399
Score = 50.1 bits (25), Expect = 1e-004
Identities = 43/49 (87%)
Strand = Plus / Minus
Query: 639 ctcggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
|||||| |||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 142 ctcggccggcttcttctcggccggcttcttctctgccttgggagccatt 94
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggcc 675
||||||||||||| |||| |||||||||||||||
Sbjct: 155 cggcaggcttcttctcggccggcttcttctcggcc 121
>gb|CV229934.1|CV229934 WS01914.B21_O15 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01914_O15 3', mRNA sequence
Length = 634
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 290 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 349
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 350 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 409
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 410 ctcttctttgccttcttcttc 430
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 507 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 553
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 221 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 263
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 132 cctaagagctagtgaacttggtaacggc 159
>gb|CV234273.1|CV234273 WS01214.B21_F02 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01214_F02 3', mRNA sequence
Length = 633
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 288 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 347
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 348 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 407
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 408 ctcttctttgccttcttcttc 428
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 505 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 551
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 219 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 261
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 130 cctaagagctagtgaacttggtaacggc 157
>gb|CV234291.1|CV234291 WS01214.B21_G06 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01214_G06 3', mRNA sequence
Length = 563
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 288 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 347
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 348 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 407
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 408 ctcttctttgccttcttcttc 428
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 505 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 551
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 219 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 261
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 130 cctaagagctagtgaacttggtaacggc 157
>gb|CV242497.1|CV242497 WS02515.B21_D15 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02515_D15 3', mRNA sequence
Length = 671
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 322 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 381
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 382 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 441
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 442 ctcttctttgccttcttcttc 462
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 539 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 585
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 253 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 295
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 164 cctaagagctagtgaacttggtaacggc 191
>gb|CV248041.1|CV248041 WS0112.B21_D09 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS0112_D09 3', mRNA sequence
Length = 691
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 289 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 348
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 349 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 408
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 409 ctcttctttgccttcttcttc 429
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 506 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 552
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 220 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 262
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 131 cctaagagctagtgaacttggtaacggc 158
>gb|CV248261.1|CV248261 WS01120.B21_A12 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01120_A12 3', mRNA sequence
Length = 644
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 288 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 347
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 348 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctctacg 407
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 408 ctcttctttgccttcttcttc 428
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 505 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 551
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 219 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 261
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 130 cctaagagctagtgaacttggtaacggc 157
>gb|CV248670.1|CV248670 WS01121.B21_I18 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01121_I18 3', mRNA sequence
Length = 634
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 287 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 346
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 347 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 406
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 407 ctcttctttgccttcttcttc 427
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 504 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 550
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 218 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 260
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 129 cctaagagctagtgaacttggtaacggc 156
>gb|CV250552.1|CV250552 WS0113.B21_P01 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS0113_P01 3', mRNA sequence
Length = 698
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 300 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 359
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 360 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 419
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 420 ctcttctttgccttcttcttc 440
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 517 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 563
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 231 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 273
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 142 cctaagagctagtgaacttggtaacggc 169
>gb|CV253190.1|CV253190 WS0221.B21_C12 PTxD-ICC-A-12 Populus trichocarpa x Populus
deltoides cDNA clone WS0221_C12 3', mRNA sequence
Length = 691
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 322 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 381
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 382 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 441
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 442 ctcttctttgccttcttcttc 462
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 253 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 295
Score = 50.1 bits (25), Expect = 1e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 639 ctcggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
|||||| |||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 552 ctcggccggcttcttctcggccggcttcttctctgccttgggagccatt 600
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggcc 675
||||||||||||| |||| |||||||||||||||
Sbjct: 539 cggcaggcttcttctcggccggcttcttctcggcc 573
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 164 cctaagagctagtgaacttggtaacggc 191
>gb|CV253860.1|CV253860 WS0223.B21_E05 PTxD-ICC-A-12 Populus trichocarpa x Populus
deltoides cDNA clone WS0223_E05 3', mRNA sequence
Length = 705
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 418 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 477
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 478 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 537
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 538 ctcttctttgccttcttcttc 558
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 349 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 391
Score = 50.1 bits (25), Expect = 1e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 639 ctcggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
|||||| |||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 648 ctcggccggcttcttctcggccggcttcttctctgccttgggagccatt 696
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggcc 675
||||||||||||| |||| |||||||||||||||
Sbjct: 635 cggcaggcttcttctcggccggcttcttctcggcc 669
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 260 cctaagagctagtgaacttggtaacggc 287
>gb|CV253861.1|CV253861 WS0223.B21_E06 PTxD-ICC-A-12 Populus trichocarpa x Populus
deltoides cDNA clone WS0223_E06 3', mRNA sequence
Length = 654
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 290 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 349
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 350 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 409
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 410 ctcttctttgccttcttcttc 430
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 221 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 263
Score = 50.1 bits (25), Expect = 1e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 639 ctcggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
|||||| |||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 520 ctcggccggcttcttctcggccggcttcttctctgccttgggagccatt 568
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggcc 675
||||||||||||| |||| |||||||||||||||
Sbjct: 507 cggcaggcttcttctcggccggcttcttctcggcc 541
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 132 cctaagagctagtgaacttggtaacggc 159
>gb|CV266235.1|CV266235 WS02029.B21_H11 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02029_H11 3', mRNA sequence
Length = 634
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 292 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 351
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 352 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 411
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 412 ctcttctttgccttcttcttc 432
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 509 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 555
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 223 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 265
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 134 cctaagagctagtgaacttggtaacggc 161
>gb|DT471589.1|DT471589 WS01214.BR_G06 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01214_G06 5', mRNA sequence
Length = 479
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 289 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 230
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 229 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 170
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 169 ctcttctttgccttcttcttc 149
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 358 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 316
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 72 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 26
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 447 cctaagagctagtgaacttggtaacggc 420
>gb|DT473900.1|DT473900 WS01230.BR_B13 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01230_B13 5', mRNA sequence
Length = 658
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 369 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 310
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 309 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 250
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 249 ctcttctttgccttcttcttc 229
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 438 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 396
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 152 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 106
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 527 cctaagagctagtgaacttggtaacggc 500
>gb|DT476580.1|DT476580 WS01230.B21_B13 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01230_B13 3', mRNA sequence
Length = 658
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 290 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 349
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 350 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 409
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 410 ctcttctttgccttcttcttc 430
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 507 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 553
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 221 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 263
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 132 cctaagagctagtgaacttggtaacggc 159
>gb|DT482020.1|DT482020 WS02533.BR_K09 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02533_K09 5', mRNA sequence
Length = 810
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Plus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 259 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 318
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 319 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 378
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 379 ctcttctttgccttcttcttc 399
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 476 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 522
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 190 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 232
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 101 cctaagagctagtgaacttggtaacggc 128
>gb|DT495045.1|DT495045 WS0112.BR_D09 PT-P-FL-A-2 Populus trichocarpa cDNA clone WS0112_D09
5', mRNA sequence
Length = 528
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 373 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 314
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 313 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 254
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 253 ctcttctttgccttcttcttc 233
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 442 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 400
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 156 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 110
Score = 38.2 bits (19), Expect = 0.49
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggc 263
||||||||||||||||| |||||
Sbjct: 526 gagctagtgaacttggtaacggc 504
>gb|DT495288.1|DT495288 WS01120.BR_A12 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01120_A12 5', mRNA sequence
Length = 660
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 373 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 314
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 313 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctctacg 254
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 253 ctcttctttgccttcttcttc 233
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 442 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 400
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 156 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 110
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 531 cctaagagctagtgaacttggtaacggc 504
>gb|DT495808.1|DT495808 WS01121.BR_I18 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01121_I18 5', mRNA sequence
Length = 657
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 371 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 312
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 311 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 252
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 251 ctcttctttgccttcttcttc 231
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 440 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 398
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 154 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 108
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 529 cctaagagctagtgaacttggtaacggc 502
>gb|DT497948.1|DT497948 WS0113.BR_P01 PT-P-FL-A-2 Populus trichocarpa cDNA clone WS0113_P01
5', mRNA sequence
Length = 612
Score = 73.8 bits (37), Expect = 9e-012
Identities = 115/141 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 370 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 311
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacc 513
||||| || ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 310 ccaatatcagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaacg 251
Query: 514 gacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 250 ctcttctttgccttcttcttc 230
Score = 54.0 bits (27), Expect = 8e-006
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtacc 367
||||||||||| || || || ||||||||||||||||||||||
Sbjct: 439 gtctggatctcccgagaagtaatggtaggcttcttgttgtacc 397
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 153 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 107
Score = 40.1 bits (20), Expect = 0.12
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 236 cctaggagctagtgaacttggtgacggc 263
|||| ||||||||||||||||| |||||
Sbjct: 528 cctaagagctagtgaacttggtaacggc 501
>gb|CA924860.1|CA924860 MTU7TL.P10.E07 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 495
Score = 71.9 bits (36), Expect = 3e-011
Identities = 75/88 (85%)
Strand = Plus / Plus
Query: 447 cgagatgccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgt 506
|||||| || ||||| ||||| ||||| |||| ||||||||||||||||||||||| ||
Sbjct: 229 cgagatcccgatgtcagggtgaacctgtttcaagaccttgaagatgtagatcttgtaggt 288
Query: 507 ctccaccgacttctttgccttcttcttc 534
||| || ||||||| |||||||||||
Sbjct: 289 ctcgacgttcttctttaccttcttcttc 316
>gb|CA925209.1|CA925209 MTU7TL.P15.A06 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 474
Score = 71.9 bits (36), Expect = 3e-011
Identities = 96/116 (82%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
||||||||||| || || || || ||||| ||||| ||| |||||||||| |||||
Sbjct: 309 agcttctcgaaaatatcattaataaaggaattcattatgcccatggccttgcttgagatc 250
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| || ||||| || || |||||||||||||| ||||||||||||||||| |||||
Sbjct: 249 cctatatccggatgaacttgcttcagcaccttaaagatgtagatcttgtatgtctc 194
>gb|CK318056.1|CK318056 B9P04h09 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 471
Score = 71.9 bits (36), Expect = 3e-011
Identities = 75/88 (85%)
Strand = Plus / Minus
Query: 447 cgagatgccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgt 506
|||||| || ||||| ||||| ||||| |||| ||||||||||||||||||||||| ||
Sbjct: 108 cgagatcccgatgtcagggtgaacctgtttcaagaccttgaagatgtagatcttgtaggt 49
Query: 507 ctccaccgacttctttgccttcttcttc 534
||| || |||||||||| ||||||||
Sbjct: 48 ctcgacgctcttctttgccctcttcttc 21
>gb|CV280230.1|CV280230 WS0135.B21_H07 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0135_H07 3', mRNA sequence
Length = 691
Score = 71.9 bits (36), Expect = 3e-011
Identities = 75/88 (85%)
Strand = Plus / Plus
Query: 447 cgagatgccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgt 506
|||||| || ||||| ||||| ||||| |||| ||||||||||||||||||||||| ||
Sbjct: 380 cgagatcccgatgtcagggtgaacctgtttcaagaccttgaagatgtagatcttgtaggt 439
Query: 507 ctccaccgacttctttgccttcttcttc 534
||| || |||||||||| ||||||||
Sbjct: 440 ctcgacgctcttctttgccctcttcttc 467
>gb|CX172185.1|CX172185 G11_69-14-1_13.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 643
Score = 71.9 bits (36), Expect = 3e-011
Identities = 75/88 (85%)
Strand = Plus / Minus
Query: 447 cgagatgccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgt 506
|||||| || ||||| ||||| ||||| |||| ||||||||||||||||||||||| ||
Sbjct: 274 cgagatcccgatgtcagggtgaacctgtttcaagaccttgaagatgtagatcttgtaggt 215
Query: 507 ctccaccgacttctttgccttcttcttc 534
||| || |||||||||| ||||||||
Sbjct: 214 ctcgacgctcttctttgccctcttcttc 187
>gb|DT503098.1|DT503098 WS0135.BR_H07 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0135_H07 5', mRNA sequence
Length = 656
Score = 71.9 bits (36), Expect = 3e-011
Identities = 75/88 (85%)
Strand = Plus / Minus
Query: 447 cgagatgccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgt 506
|||||| || ||||| ||||| ||||| |||| ||||||||||||||||||||||| ||
Sbjct: 277 cgagatcccgatgtcagggtgaacctgtttcaagaccttgaagatgtagatcttgtaggt 218
Query: 507 ctccaccgacttctttgccttcttcttc 534
||| || |||||||||| ||||||||
Sbjct: 217 ctcgacgctcttctttgccctcttcttc 190
>gb|DN495281.1|DN495281 N032D05.5pR Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA clone N032D05 5', mRNA sequence
Length = 453
Score = 67.9 bits (34), Expect = 5e-010
Identities = 76/90 (84%)
Strand = Plus / Minus
Query: 277 gagacggcgtgcttggcgagctcgccggggaggacgaggcggacggaggtctggatctcg 336
|||| ||||||||||| ||||| |||||||||| ||||||||| | ||| ||||||||
Sbjct: 185 gagatggcgtgcttggaaagctcaccggggaggatgaggcggacagcggtgtggatctct 126
Query: 337 cgggacgtgatggtaggcttcttgttgtac 366
|| ||| |||||| | |||||||||||||
Sbjct: 125 cgccacgagatggtcgacttcttgttgtac 96
>gb|DT471569.1|DT471569 WS01214.BR_F02 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01214_F02 5', mRNA sequence
Length = 528
Score = 67.9 bits (34), Expect = 5e-010
Identities = 116/142 (81%), Gaps = 1/142 (0%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
|||||||| ||||| || |||||||| ||||||||| ||| |||||| |||||
Sbjct: 371 agcttctcaaagatatcattgatgaaactgttcatgatacccattgccttgcttgagatc 312
Query: 454 ccaatgtcc-gggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccac 512
||||| ||| ||||| ||||| |||| || |||||||||||||||||||| ||||| ||
Sbjct: 311 ccaatatccagggtgtacctgtttcaagactttgaagatgtagatcttgtaggtctcaac 252
Query: 513 cgacttctttgccttcttcttc 534
|||||||||||||||||||
Sbjct: 251 gctcttctttgccttcttcttc 230
Score = 54.0 bits (27), Expect = 8e-006
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 641 cggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||||||| |||| ||||||||||| |||||||| ||||||
Sbjct: 153 cggcaggcttcttctcggccggcttcttctctgccttgggagccatt 107
Score = 40.1 bits (20), Expect = 0.12
Identities = 39/44 (88%), Gaps = 1/44 (2%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatg-gtaggcttcttgttgtacc 367
||||||||||| || || || ||| |||||||||||||||||||
Sbjct: 441 gtctggatctcccgagaagtaatgngtaggcttcttgttgtacc 398
Score = 38.2 bits (19), Expect = 0.49
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 241 gagctagtgaacttggtgacggc 263
||||||||||||||||| |||||
Sbjct: 525 gagctagtgaacttggtaacggc 503
>gb|CF229833.1|CF229833 PtaxmjxtD11D1107 Poplar cDNA library from mature xylem Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 607
Score = 65.9 bits (33), Expect = 2e-009
Identities = 83/99 (83%), Gaps = 3/99 (3%)
Strand = Plus / Minus
Query: 592 gccttgggcttcttccccgccgtggccttctccgccgccggctcct---cctcggcaggc 648
||||| ||||||||| | |||| ||| ||||||||| ||| || || ||||||| |||
Sbjct: 170 gccttcggcttcttctctgccggggctttctccgccaccgtcttcttctcctcggccggc 111
Query: 649 ttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||| |||||||||||||||||||||| || ||||||
Sbjct: 110 ttcttctcggcgggcttcttctcggcctttggtgccatt 72
Score = 44.1 bits (22), Expect = 0.008
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 481 accttgaagatgtagatcttgtacgtctcc 510
|||||||||||||| |||||||| ||||||
Sbjct: 275 accttgaagatgtaaatcttgtatgtctcc 246
>gb|AI162042.1|AI162042 A011P36U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 632
Score = 63.9 bits (32), Expect = 8e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtaccg 368
||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 317 gtctggatctcccgggacgtaatggtaggcttcttgttataccg 274
>gb|BI122268.1|BI122268 I004P48P Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 574
Score = 63.9 bits (32), Expect = 8e-009
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
||||||||||| || || || || ||||| ||||| ||| |||||||||| |||||
Sbjct: 328 agcttctcgaaaatatcattaataaaggaattcattatgcccatggccttgcttgagatc 269
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| || || || || || |||||||||||||| ||||||||||||||||| |||||
Sbjct: 268 cctatatctggatgaacttgcttcagcaccttaaagatgtagatcttgtatgtctc 213
>gb|BI128737.1|BI128737 G080P69Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 563
Score = 63.9 bits (32), Expect = 8e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtaccg 368
||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 377 gtctggatctcccgggacgtaatggtaggcttcttgttataccg 334
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 481 accttgaagatgtagatcttgtacgtctccac 512
|||||||||||||| |||||||| ||||||||
Sbjct: 221 accttgaagatgtaaatcttgtaggtctccac 190
>gb|BI129027.1|BI129027 G084P91Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 440
Score = 63.9 bits (32), Expect = 8e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtaccg 368
||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 348 gtctggatctcccgggacgtaatggtaggcttcttgttataccg 305
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 481 accttgaagatgtagatcttgtacgtctccac 512
|||||||||||||| |||||||| ||||||||
Sbjct: 192 accttgaagatgtaaatcttgtaggtctccac 161
>gb|BI131112.1|BI131112 G115P54Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 522
Score = 63.9 bits (32), Expect = 8e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtaccg 368
||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 377 gtctggatctcccgggacgtaatggtaggcttcttgttataccg 334
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 481 accttgaagatgtagatcttgtacgtctccac 512
|||||||||||||| |||||||| ||||||||
Sbjct: 221 accttgaagatgtaaatcttgtaggtctccac 190
>gb|BI138539.1|BI138539 F108P76Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 470
Score = 63.9 bits (32), Expect = 8e-009
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
||||||||||| || || || || ||||| ||||| ||| |||||||||| |||||
Sbjct: 304 agcttctcgaaaatatcattaataaaggaattcattatgcccatggccttgcttgagatc 245
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| || || || || || |||||||||||||| ||||||||||||||||| |||||
Sbjct: 244 cctatatctggatgaacttgcttcagcaccttaaagatgtagatcttgtatgtctc 189
>gb|BU809056.1|BU809056 UL53B04 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 465
Score = 63.9 bits (32), Expect = 8e-009
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
||||||||||| || || || || ||||| ||||| ||| |||||||||| |||||
Sbjct: 324 agcttctcgaaaatatcattaataaaggaattcattatgcccatggccttgcttgagatc 265
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| || || || || || |||||||||||||| ||||||||||||||||| |||||
Sbjct: 264 cctatatctggatgaacttgcttcagcaccttaaagatgtagatcttgtatgtctc 209
>gb|BU815977.1|BU815977 N058E08 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 563
Score = 63.9 bits (32), Expect = 8e-009
Identities = 47/52 (90%)
Strand = Plus / Minus
Query: 636 ctcctcggcaggcttcttggcggcgggcttcttctcggccttgggcgccatt 687
||||||||| |||||||| |||||||||||||||||||||| || ||||||
Sbjct: 99 ctcctcggccggcttcttctcggcgggcttcttctcggcctttggtgccatt 48
Score = 44.1 bits (22), Expect = 0.008
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 481 accttgaagatgtagatcttgtacgtctcc 510
|||||||||||||| |||||||| ||||||
Sbjct: 251 accttgaagatgtaaatcttgtatgtctcc 222
>gb|BU831303.1|BU831303 T020A01 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 722
Score = 63.9 bits (32), Expect = 8e-009
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 394 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 453
||||||||||| || || || || ||||| ||||| ||| |||||||||| |||||
Sbjct: 332 agcttctcgaaaatatcattaataaaggaattcattatgcccatggccttgcttgagatc 273
Query: 454 ccaatgtccgggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctc 509
|| || || || || || |||||||||||||| ||||||||||||||||| |||||
Sbjct: 272 cctatatctggatgaacttgcttcagcaccttaaagatgtagatcttgtatgtctc 217
>gb|BU831635.1|BU831635 T024A01 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 539
Score = 63.9 bits (32), Expect = 8e-009
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 325 gtctggatctcgcgggacgtgatggtaggcttcttgttgtaccg 368
||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 397 gtctggatctcccgggacgtaatggtaggcttcttgttataccg 354
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 481 accttgaagatgtagatcttgtacgtctccac 512
|||||||||||||| |||||||| ||||||||
Sbjct: 241 accttgaagatgtaaatcttgtaggtctccac 210
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 91,167
Number of Sequences: 369679
Number of extensions: 91167
Number of successful extensions: 26724
Number of sequences better than 0.5: 411
Number of HSP's better than 0.5 without gapping: 410
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 25190
Number of HSP's gapped (non-prelim): 1470
length of query: 777
length of database: 203,408,664
effective HSP length: 19
effective length of query: 758
effective length of database: 196,384,763
effective search space: 148859650354
effective search space used: 148859650354
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)