BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBS7b05.xg.2.1
(526 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW697996.1|AW697996 NXNV_079_C07_F Nsf Xylem Normal wood... 74 6e-012
gb|AH014290.1|SEG_AY764673S Pinus taeda isolate 11 cellulos... 74 6e-012
gb|AY764674.1|AY764673S2 Pinus taeda isolate 11 cellulose s... 74 6e-012
gb|BG039685.1|BG039685 NXSI_102_H08_F NXSI (Nsf Xylem Side ... 68 4e-010
gb|BQ695648.1|BQ695648 NXPV_030_H04_F NXPV (Nsf Xylem Plani... 68 4e-010
gb|BQ697774.1|BQ697774 NXPV_052_F10_F NXPV (Nsf Xylem Plani... 68 4e-010
gb|BQ703105.1|BQ703105 NXSI_136_D09_F NXSI (Nsf Xylem Side ... 68 4e-010
gb|DR060720.1|DR060720 RTNIT1_29_C08.g1_A029 Roots minus ni... 68 4e-010
dbj|BD236020.1| Materials and method for modification of pl... 68 4e-010
gb|AY639654.1| Pinus radiata cellulose synthase catalytic s... 68 4e-010
gb|AH014291.1|SEG_AY764675S Pinus taeda isolate 16 cellulos... 68 4e-010
gb|AY764676.1|AY764675S2 Pinus taeda isolate 16 cellulose s... 68 4e-010
gb|AH014292.1|SEG_AY764677S Pinus taeda isolate 25 cellulos... 68 4e-010
gb|AY764678.1|AY764677S2 Pinus taeda isolate 25 cellulose s... 68 4e-010
gb|AH014293.1|SEG_AY764679S Pinus taeda isolate 7 cellulose... 68 4e-010
gb|AY764680.1|AY764679S2 Pinus taeda isolate 7 cellulose sy... 68 4e-010
gb|AH014294.1|SEG_AY764681S Pinus taeda isolate 6 cellulose... 68 4e-010
gb|AY764682.1|AY764681S2 Pinus taeda isolate 6 cellulose sy... 68 4e-010
gb|AH014295.1|SEG_AY764683S Pinus taeda isolate 4 cellulose... 68 4e-010
gb|AY764684.1|AY764683S2 Pinus taeda isolate 4 cellulose sy... 68 4e-010
gb|AH014296.1|SEG_AY764685S Pinus taeda isolate 26 cellulos... 68 4e-010
gb|AY764686.1|AY764685S2 Pinus taeda isolate 26 cellulose s... 68 4e-010
gb|AH014297.1|SEG_AY764687S Pinus taeda isolate 9 cellulose... 68 4e-010
gb|AY764688.1|AY764687S2 Pinus taeda isolate 9 cellulose sy... 68 4e-010
gb|AH014298.1|SEG_AY764689S Pinus taeda isolate 23 cellulos... 68 4e-010
gb|AY764690.1|AY764689S2 Pinus taeda isolate 23 cellulose s... 68 4e-010
gb|AH014299.1|SEG_AY764691S Pinus taeda isolate 13 cellulos... 68 4e-010
gb|AY764692.1|AY764691S2 Pinus taeda isolate 13 cellulose s... 68 4e-010
gb|AH014300.1|SEG_AY764693S Pinus taeda isolate 30 cellulos... 68 4e-010
gb|AY764694.1|AY764693S2 Pinus taeda isolate 30 cellulose s... 68 4e-010
gb|AH014301.1|SEG_AY764695S Pinus taeda isolate 22 cellulos... 68 4e-010
gb|AY764696.1|AY764695S2 Pinus taeda isolate 22 cellulose s... 68 4e-010
gb|AH014302.1|SEG_AY764697S Pinus taeda isolate 32 cellulos... 68 4e-010
gb|AY764698.1|AY764697S2 Pinus taeda isolate 32 cellulose s... 68 4e-010
gb|AH014303.1|SEG_AY764699S Pinus taeda isolate 18 cellulos... 68 4e-010
gb|AY764700.1|AY764699S2 Pinus taeda isolate 18 cellulose s... 68 4e-010
gb|AH014304.1|SEG_AY764701S Pinus taeda isolate 10 cellulos... 68 4e-010
gb|AY764702.1|AY764701S2 Pinus taeda isolate 10 cellulose s... 68 4e-010
gb|AH014305.1|SEG_AY764703S Pinus taeda isolate 14 cellulos... 68 4e-010
gb|AY764704.1|AY764703S2 Pinus taeda isolate 14 cellulose s... 68 4e-010
gb|AH014306.1|SEG_AY764705S Pinus taeda isolate 21 cellulos... 68 4e-010
gb|AY764706.1|AY764705S2 Pinus taeda isolate 21 cellulose s... 68 4e-010
gb|AH014307.1|SEG_AY764707S Pinus taeda isolate 31 cellulos... 68 4e-010
gb|AY764708.1|AY764707S2 Pinus taeda isolate 31 cellulose s... 68 4e-010
gb|AH014308.1|SEG_AY764709S Pinus taeda isolate 5 cellulose... 68 4e-010
gb|AY764710.1|AY764709S2 Pinus taeda isolate 5 cellulose sy... 68 4e-010
gb|AH014309.1|SEG_AY764711S Pinus taeda isolate 2 cellulose... 68 4e-010
gb|AY764712.1|AY764711S2 Pinus taeda isolate 2 cellulose sy... 68 4e-010
gb|AH014310.1|SEG_AY764713S Pinus taeda isolate 3 cellulose... 68 4e-010
gb|AY764714.1|AY764713S2 Pinus taeda isolate 3 cellulose sy... 68 4e-010
gb|AH014311.1|SEG_AY764715S Pinus taeda isolate 19 cellulos... 68 4e-010
gb|AY764716.1|AY764715S2 Pinus taeda isolate 19 cellulose s... 68 4e-010
gb|AH014312.1|SEG_AY764717S Pinus taeda isolate 28 cellulos... 68 4e-010
gb|AY764718.1|AY764717S2 Pinus taeda isolate 28 cellulose s... 68 4e-010
gb|AH014313.1|SEG_AY764719S Pinus taeda isolate 17 cellulos... 68 4e-010
gb|AY764720.1|AY764719S2 Pinus taeda isolate 17 cellulose s... 68 4e-010
gb|AH014314.1|SEG_AY764721S Pinus taeda isolate 8 cellulose... 68 4e-010
gb|AY764722.1|AY764721S2 Pinus taeda isolate 8 cellulose sy... 68 4e-010
gb|AH014315.1|SEG_AY764723S Pinus taeda isolate 15 cellulos... 68 4e-010
gb|AY764724.1|AY764723S2 Pinus taeda isolate 15 cellulose s... 68 4e-010
gb|AH014316.1|SEG_AY764725S Pinus taeda isolate 1 cellulose... 68 4e-010
gb|AY764726.1|AY764725S2 Pinus taeda isolate 1 cellulose sy... 68 4e-010
gb|AH014317.1|SEG_AY764727S Pinus taeda isolate 29 cellulos... 68 4e-010
gb|AY764728.1|AY764727S2 Pinus taeda isolate 29 cellulose s... 68 4e-010
gb|AH014320.1|SEG_AY764733S Pinus taeda isolate 12 cellulos... 68 4e-010
gb|AY764734.1|AY764733S2 Pinus taeda isolate 12 cellulose s... 68 4e-010
gb|AH014321.1|SEG_AY764735S Pinus taeda isolate 24 cellulos... 68 4e-010
gb|AY764736.1|AY764735S2 Pinus taeda isolate 24 cellulose s... 68 4e-010
gb|AH014318.1|SEG_AY764729S Pinus taeda isolate 20 cellulos... 60 9e-008
gb|AY764730.1|AY764729S2 Pinus taeda isolate 20 cellulose s... 60 9e-008
gb|AH014319.1|SEG_AY764731S Pinus taeda isolate 27 cellulos... 60 9e-008
gb|AY764732.1|AY764731S2 Pinus taeda isolate 27 cellulose s... 60 9e-008
gb|AY789652.1| Pinus taeda cellulose synthase catalytic sub... 60 9e-008
gb|DR682518.1|DR682518 EST1072593 Normalized pine embryo li... 52 2e-005
gb|BM428045.1|BM428045 NXRV_008_A09_F NXRV (Nsf Xylem Root ... 48 4e-004
gb|AW064806.1|AW064806 ST36A06 Pine TriplEx shoot tip libra... 42 0.022
gb|AL749837.1|AL749837 AL749837 AS Pinus pinaster cDNA clon... 42 0.022
gb|CF478733.1|CF478733 RTWW3_16_G10.g1_A022 Well-watered lo... 42 0.022
gb|CR393499.1|CR393499 CR393499 RN Pinus pinaster cDNA clon... 42 0.022
gb|CV031645.1|CV031645 RTNACL1_2_G07.g1_A029 Roots plus add... 42 0.022
gb|CX651410.1|CX651410 COLD1_52_E07.b1_A029 Root cold Pinus... 42 0.022
gb|DR096307.1|DR096307 STRR1_27_D08.b1_A033 Stem Response R... 42 0.022
gb|DR096386.1|DR096386 STRR1_27_D08.g1_A033 Stem Response R... 42 0.022
gb|BV079716.1| Pp_CesA4 Pinus pinaster megagametophytes Pin... 42 0.022
gb|AW495797.1|AW495797 NXNV_065_E11_FF Nsf Xylem Normal woo... 40 0.088
gb|BX251307.1|BX251307 BX251307 Pinus pinaster differenciat... 40 0.088
gb|BQ695964.1|BQ695964 NXPV_034_H04_F NXPV (Nsf Xylem Plani... 40 0.088
gb|BQ698119.1|BQ698119 NXPV_064_G05_F NXPV (Nsf Xylem Plani... 40 0.088
gb|BQ698366.1|BQ698366 NXPV_069_A10_F NXPV (Nsf Xylem Plani... 40 0.088
gb|CD023046.1|CD023046 NXPV_098_A07_F NXPV (Nsf Xylem Plani... 40 0.088
gb|CD027755.1|CD027755 NXNV_065_E11_F Nsf Xylem Normal wood... 40 0.088
gb|CO369885.1|CO369885 RTK1_55_A04.b1_A029 Roots minus pota... 40 0.088
gb|CX647876.1|CX647876 COLD1_25_C03.b1_A029 Root cold Pinus... 40 0.088
gb|DR017425.1|DR017425 STRS1_16_E10.b1_A034 Shoot tip pitch... 40 0.088
gb|DR089385.1|DR089385 RTAL1_8_G12.b1_A029 Roots plus added... 40 0.088
gb|DR689610.1|DR689610 EST1079696 Normalized pine embryo li... 40 0.088
gb|DR744391.1|DR744391 RTCU1_22_E01.b1_A029 Roots plus adde... 40 0.088
gb|DR746030.1|DR746030 RTCU1_34_F01.b1_A029 Roots plus adde... 40 0.088
gb|DT635390.1|DT635390 EST1150321 Normalized pine embryo li... 40 0.088
gb|BF186257.1|BF186257 NXCI_135_B10_F NXCI (Nsf Xylem Compr... 38 0.35
gb|BM493879.1|BM493879 NXLV_071_A06_F NXLV (Nsf Xylem Late ... 38 0.35
>gb|AW697996.1|AW697996 NXNV_079_C07_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_079_C07 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 352
Score = 73.8 bits (37), Expect = 6e-012
Identities = 103/125 (82%)
Strand = Plus / Minus
Query: 341 gaccagatgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaac 400
|||||||| || || |||||||| || |||||||| | |||||||| |||||||||||
Sbjct: 142 gaccagataaccacgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaa 83
Query: 401 gggtagaggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccac 460
|| || ||||| || ||||||||||| || ||||| ||||| || ||||| || |||||
Sbjct: 82 ggatacaggtgcacaatgacccagaatgcaaagaaaagcttacccaagagaggaccccat 23
Query: 461 gactg 465
|||||
Sbjct: 22 gactg 18
>gb|AH014290.1|SEG_AY764673S Pinus taeda isolate 11 cellulose synthase genes, partial cds
Length = 1023
Score = 73.8 bits (37), Expect = 6e-012
Identities = 103/125 (82%)
Strand = Plus / Minus
Query: 341 gaccagatgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaac 400
|||||||| || || |||||||| || |||||||| | |||||||| |||||||||||
Sbjct: 852 gaccagataaccacgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaa 793
Query: 401 gggtagaggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccac 460
|| || ||||| || ||||||||||| || ||||| ||||| || ||||| || |||||
Sbjct: 792 ggatacaggtgcacaatgacccagaatgcaaagaaaagcttacccaagagaggaccccat 733
Query: 461 gactg 465
|||||
Sbjct: 732 gactg 728
>gb|AY764674.1|AY764673S2 Pinus taeda isolate 11 cellulose synthase gene, partial cds
Length = 452
Score = 73.8 bits (37), Expect = 6e-012
Identities = 103/125 (82%)
Strand = Plus / Minus
Query: 341 gaccagatgacgacaatggtgggcgtccggttctggcgccccatgagccccttgaggaac 400
|||||||| || || |||||||| || |||||||| | |||||||| |||||||||||
Sbjct: 281 gaccagataaccacgatggtgggtgttcggttctgcctgcccatgagacccttgaggaaa 222
Query: 401 gggtagaggtggacgatgacccagaaggcgaagaagagcttgccgaagagcgggccccac 460
|| || ||||| || ||||||||||| || ||||| ||||| || ||||| || |||||
Sbjct: 221 ggatacaggtgcacaatgacccagaatgcaaagaaaagcttacccaagagaggaccccat 162
Query: 461 gactg 465
|||||
Sbjct: 161 gactg 157
>gb|BG039685.1|BG039685 NXSI_102_H08_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_102_H08 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 546
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 231 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 172
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 171 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 122
>gb|BQ695648.1|BQ695648 NXPV_030_H04_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_030_H04 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 491
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 180 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 121
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 120 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 71
>gb|BQ697774.1|BQ697774 NXPV_052_F10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_052_F10 5' similar to Arabidopsis
thaliana sequence At5g17420 cellulose synthase catalytic
subunit (IRX3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 523
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 180 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 121
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 120 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 71
>gb|BQ703105.1|BQ703105 NXSI_136_D09_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_136_D09 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 483
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 213 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 154
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 153 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 104
>gb|DR060720.1|DR060720 RTNIT1_29_C08.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_29_C08_A029 5', mRNA sequence
Length = 789
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Plus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 628 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 687
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 688 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 737
>dbj|BD236020.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 3851
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 3289 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 3230
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 3229 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 3180
>gb|AY639654.1| Pinus radiata cellulose synthase catalytic subunit (CesA1) mRNA,
complete cds
Length = 3911
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 3305 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 3246
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 3245 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 3196
>gb|AH014291.1|SEG_AY764675S Pinus taeda isolate 16 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764676.1|AY764675S2 Pinus taeda isolate 16 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014292.1|SEG_AY764677S Pinus taeda isolate 25 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764678.1|AY764677S2 Pinus taeda isolate 25 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014293.1|SEG_AY764679S Pinus taeda isolate 7 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764680.1|AY764679S2 Pinus taeda isolate 7 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014294.1|SEG_AY764681S Pinus taeda isolate 6 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764682.1|AY764681S2 Pinus taeda isolate 6 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014295.1|SEG_AY764683S Pinus taeda isolate 4 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764684.1|AY764683S2 Pinus taeda isolate 4 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014296.1|SEG_AY764685S Pinus taeda isolate 26 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764686.1|AY764685S2 Pinus taeda isolate 26 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014297.1|SEG_AY764687S Pinus taeda isolate 9 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764688.1|AY764687S2 Pinus taeda isolate 9 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014298.1|SEG_AY764689S Pinus taeda isolate 23 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764690.1|AY764689S2 Pinus taeda isolate 23 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014299.1|SEG_AY764691S Pinus taeda isolate 13 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764692.1|AY764691S2 Pinus taeda isolate 13 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014300.1|SEG_AY764693S Pinus taeda isolate 30 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764694.1|AY764693S2 Pinus taeda isolate 30 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014301.1|SEG_AY764695S Pinus taeda isolate 22 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764696.1|AY764695S2 Pinus taeda isolate 22 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014302.1|SEG_AY764697S Pinus taeda isolate 32 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764698.1|AY764697S2 Pinus taeda isolate 32 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014303.1|SEG_AY764699S Pinus taeda isolate 18 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764700.1|AY764699S2 Pinus taeda isolate 18 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014304.1|SEG_AY764701S Pinus taeda isolate 10 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764702.1|AY764701S2 Pinus taeda isolate 10 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014305.1|SEG_AY764703S Pinus taeda isolate 14 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764704.1|AY764703S2 Pinus taeda isolate 14 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014306.1|SEG_AY764705S Pinus taeda isolate 21 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764706.1|AY764705S2 Pinus taeda isolate 21 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014307.1|SEG_AY764707S Pinus taeda isolate 31 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764708.1|AY764707S2 Pinus taeda isolate 31 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014308.1|SEG_AY764709S Pinus taeda isolate 5 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764710.1|AY764709S2 Pinus taeda isolate 5 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014309.1|SEG_AY764711S Pinus taeda isolate 2 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764712.1|AY764711S2 Pinus taeda isolate 2 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
>gb|AH014310.1|SEG_AY764713S Pinus taeda isolate 3 cellulose synthase genes, partial cds
Length = 1023
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 837 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 778
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 777 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 728
>gb|AY764714.1|AY764713S2 Pinus taeda isolate 3 cellulose synthase gene, partial cds
Length = 452
Score = 67.9 bits (34), Expect = 4e-010
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 356 atggtgggcgtccggttctggcgccccatgagccccttgaggaacgggtagaggtggacg 415
|||||||| || |||||||| | |||||||| ||||||||||| || || ||||| ||
Sbjct: 266 atggtgggtgttcggttctgcctgcccatgagacccttgaggaaaggatacaggtgcaca 207
Query: 416 atgacccagaaggcgaagaagagcttgccgaagagcgggccccacgactg 465
||||||||||| || ||||| ||||| || ||||| || ||||| |||||
Sbjct: 206 atgacccagaatgcaaagaaaagcttacccaagagaggaccccatgactg 157
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 56,685
Number of Sequences: 355925
Number of extensions: 56685
Number of successful extensions: 12584
Number of sequences better than 0.5: 103
Number of HSP's better than 0.5 without gapping: 103
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12385
Number of HSP's gapped (non-prelim): 199
length of query: 526
length of database: 217,277,237
effective HSP length: 19
effective length of query: 507
effective length of database: 210,514,662
effective search space: 106730933634
effective search space used: 106730933634
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)