BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBD3a09.xg.3.1
(1105 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX250070.1|BX250070 BX250070 Pinus pinaster differenciat... 48 8e-004
gb|BX250618.1|BX250618 BX250618 Pinus pinaster differenciat... 48 8e-004
gb|CO161136.1|CO161136 FLD1_26_H05.g1_A029 Root flooded Pin... 48 8e-004
gb|DR070708.1|DR070708 RTDK1_15_C12.b1_A029 Roots, dark Pin... 48 8e-004
gb|DR070788.1|DR070788 RTDK1_15_C12.g1_A029 Roots, dark Pin... 48 8e-004
gb|BX252804.1|BX252804 BX252804 Pinus pinaster differenciat... 44 0.012
>gb|BX250070.1|BX250070 BX250070 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP032A11, mRNA sequence
Length = 674
Score = 48.1 bits (24), Expect = 8e-004
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattggtattgc 539
|||||||| ||||| || ||||| |||||||||||||| |||||
Sbjct: 462 caagatgctgatcgtcttgatgctattggggcaattggaattgc 505
>gb|BX250618.1|BX250618 BX250618 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP039B11, mRNA sequence
Length = 675
Score = 48.1 bits (24), Expect = 8e-004
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattggtattgc 539
|||||||| ||||| || ||||| |||||||||||||| |||||
Sbjct: 462 caagatgctgatcgtcttgatgctattggggcaattggaattgc 505
>gb|CO161136.1|CO161136 FLD1_26_H05.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_26_H05_A029 5', mRNA sequence
Length = 820
Score = 48.1 bits (24), Expect = 8e-004
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattggtattgc 539
|||||||| ||||| || ||||| |||||||||||||| |||||
Sbjct: 365 caagatgctgatcgtcttgatgctattggggcaattggaattgc 408
>gb|DR070708.1|DR070708 RTDK1_15_C12.b1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_15_C12_A029 3', mRNA sequence
Length = 829
Score = 48.1 bits (24), Expect = 8e-004
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattggtattgc 539
|||||||| ||||| || ||||| |||||||||||||| |||||
Sbjct: 271 caagatgctgatcgtcttgatgctattggggcaattggaattgc 314
>gb|DR070788.1|DR070788 RTDK1_15_C12.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_15_C12_A029 5', mRNA sequence
Length = 838
Score = 48.1 bits (24), Expect = 8e-004
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattggtattgc 539
|||||||| ||||| || ||||| |||||||||||||| |||||
Sbjct: 468 caagatgctgatcgtcttgatgctattggggcaattggaattgc 511
>gb|BX252804.1|BX252804 BX252804 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP071A03, mRNA sequence
Length = 662
Score = 44.1 bits (22), Expect = 0.012
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 496 caagatgcagatcgcctggatgcaattggggcaattgg 533
|||||||| ||||| || ||||| ||||||||||||||
Sbjct: 462 caagatgctgatcgtcttgatgctattggggcaattgg 499
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 149,348
Number of Sequences: 355925
Number of extensions: 149348
Number of successful extensions: 38545
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38530
Number of HSP's gapped (non-prelim): 15
length of query: 1105
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1086
effective length of database: 210,514,662
effective search space: 228618922932
effective search space used: 228618922932
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)