BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= L18925.2.1
(1221 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL749789.1|AL749789 AL749789 AS Pinus pinaster cDNA clon... 58 9e-007
gb|CX645838.1|CX645838 COLD1_5_D01.g1_A029 Root cold Pinus ... 56 4e-006
gb|DR177222.1|DR177222 RTMNUT1_3_H10.g1_A029 Roots minus mi... 56 4e-006
gb|U90346.1|PRU90346 Pinus radiata putative MADS box transc... 56 4e-006
gb|AF006210.1|AF006210 Pinus resinosa MADS box transcriptio... 56 4e-006
gb|AF023615.1|AF023615 Pinus radiata MADS box protein mRNA,... 56 4e-006
gb|AW010611.1|AW010611 ST08G08 Pine TriplEx shoot tip libra... 52 5e-005
gb|AW754659.1|AW754659 PC04G10 Pine TriplEx pollen cone lib... 52 5e-005
gb|BM134188.1|BM134188 NXLV_017_H01_F NXLV (Nsf Xylem Late ... 50 2e-004
gb|CF386447.1|CF386447 RTDR1_14_B10.g1_A015 Loblolly pine r... 48 9e-004
gb|CF394057.1|CF394057 RTDS2_3_D04.b1_A021 Drought-stressed... 48 9e-004
gb|CF668263.1|CF668263 RTCNT1_35_A03.g1_A029 Root control P... 48 9e-004
gb|CO200411.1|CO200411 GEO2_7_G03.b1_A032 Root gravitropism... 48 9e-004
gb|CO200495.1|CO200495 GEO2_7_G03.g1_A032 Root gravitropism... 48 9e-004
gb|CO201105.1|CO201105 RTCNT2_3_D12.g1_A029 Root control 2 ... 48 9e-004
gb|CO361066.1|CO361066 NDL2_2_B04.g1_A029 Needles control 2... 48 9e-004
gb|CO364847.1|CO364847 RTK1_22_D10.b1_A029 Roots minus pota... 48 9e-004
gb|CV031753.1|CV031753 RTNACL1_3_B05.g1_A029 Roots plus add... 48 9e-004
gb|DR058437.1|DR058437 RTNIT1_11_F11.g1_A029 Roots minus ni... 48 9e-004
gb|DR081124.1|DR081124 RTFEPL1_27_C11.g1_A029 Roots plus ad... 48 9e-004
gb|DR178004.1|DR178004 RTMNUT1_8_E05.g1_A029 Roots minus mi... 48 9e-004
gb|U90344.1|PRU90344 Pinus radiata putative MADS box transc... 48 9e-004
gb|CF388137.1|CF388137 RTDR2_1_D05.b1_A021 Loblolly pine ro... 44 0.013
gb|CF389852.1|CF389852 RTDR2_11_B08.b1_A021 Loblolly pine r... 44 0.013
gb|CF389963.1|CF389963 RTDR2_11_B08.g1_A021 Loblolly pine r... 44 0.013
gb|CO161503.1|CO161503 FLD1_29_F09.b1_A029 Root flooded Pin... 44 0.013
gb|CO161575.1|CO161575 FLD1_29_F09.g1_A029 Root flooded Pin... 44 0.013
gb|CX713803.1|CX713803 RTPQ1_13_F12.b1_A032 Roots treated w... 44 0.013
gb|DR013883.1|DR013883 HEAT1_22_D05.b1_A029 Root at 37 C fo... 44 0.013
gb|CF665739.1|CF665739 RTCNT1_18_D05.b1_A029 Root control P... 42 0.053
gb|CV033251.1|CV033251 RTNACL1_33_G03.b1_A029 Roots plus ad... 42 0.053
gb|DR167777.1|DR167777 RTPHOS1_21_A12.b1_A029 Roots minus p... 42 0.053
gb|BG318417.1|BG318417 NXPV_013_D07_F NXPV (Nsf Xylem Plani... 40 0.21
gb|BG625803.1|BG625803 NXPV_066_C06_F NXPV (Nsf Xylem Plani... 40 0.21
gb|CF385287.1|CF385287 RTDR1_3_B08.b1_A015 Loblolly pine ro... 40 0.21
gb|CF385426.1|CF385426 RTDR1_3_B08.g1_A015 Loblolly pine ro... 40 0.21
gb|CF471239.1|CF471239 RTDS1_2_F01.b1_A015 Drought-stressed... 40 0.21
gb|CF471300.1|CF471300 RTDS1_2_F01.g1_A015 Drought-stressed... 40 0.21
gb|CF472866.1|CF472866 RTDS1_12_A11.b1_A015 Drought-stresse... 40 0.21
gb|CF475501.1|CF475501 RTWW2_12_G12.g1_A021 Well-watered lo... 40 0.21
gb|CO199860.1|CO199860 GEO2_4_A06.b1_A032 Root gravitropism... 40 0.21
gb|CV033324.1|CV033324 RTNACL1_33_G03.g1_A029 Roots plus ad... 40 0.21
gb|DR112977.1|DR112977 RTS1_32_C04.b1_A029 Roots minus sulf... 40 0.21
gb|DR384822.1|DR384822 RTHG1_4_G03.g1_A029 Roots plus added... 40 0.21
>gb|AL749789.1|AL749789 AL749789 AS Pinus pinaster cDNA clone AS01A11 similar to MADS-BOX,
mRNA sequence
Length = 349
Score = 58.0 bits (29), Expect = 9e-007
Identities = 35/37 (94%)
Strand = Plus / Minus
Query: 1049 acctgccggctcgtgttgttctcgatcctcttgatct 1085
||||||| |||||||||||||||||||||||| ||||
Sbjct: 142 acctgcctgctcgtgttgttctcgatcctcttcatct 106
>gb|CX645838.1|CX645838 COLD1_5_D01.g1_A029 Root cold Pinus taeda cDNA clone COLD1_5_D01_A029
5', mRNA sequence
Length = 705
Score = 56.0 bits (28), Expect = 4e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 975 ccacctcagcgtcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggc 1034
|||| ||||| |||||||| || ||||||||||| || ||||| || ||||| |||||||
Sbjct: 296 ccacttcagcatcgcagagcaccgagagctcgtaagctttcttcagcagcccgttgcggc 237
Query: 1035 gctt 1038
||||
Sbjct: 236 gctt 233
>gb|DR177222.1|DR177222 RTMNUT1_3_H10.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_3_H10_A029 5', mRNA sequence
Length = 770
Score = 56.0 bits (28), Expect = 4e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 975 ccacctcagcgtcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggc 1034
|||| ||||| |||||||| || ||||||||||| || ||||| || ||||| |||||||
Sbjct: 309 ccacttcagcatcgcagagcaccgagagctcgtaagctttcttcagcagcccgttgcggc 250
Query: 1035 gctt 1038
||||
Sbjct: 249 gctt 246
>gb|U90346.1|PRU90346 Pinus radiata putative MADS box transcription factor PrMADS5 mRNA,
complete cds
Length = 1301
Score = 56.0 bits (28), Expect = 4e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 975 ccacctcagcgtcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggc 1034
|||| ||||| |||||||| || ||||||||||| || ||||| || ||||| |||||||
Sbjct: 298 ccacttcagcatcgcagagcaccgagagctcgtaagctttcttcagcagcccgttgcggc 239
Query: 1035 gctt 1038
||||
Sbjct: 238 gctt 235
>gb|AF006210.1|AF006210 Pinus resinosa MADS box transcription factor mRNA, complete cds
Length = 1726
Score = 56.0 bits (28), Expect = 4e-006
Identities = 106/132 (80%)
Strand = Plus / Minus
Query: 959 gagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtacgccttcttg 1018
|||||||||||||||||||| || || || || || || || | || |||||||||||
Sbjct: 620 gagaagacgatgagggccacttctgcatcacaaagaactgataattcatacgccttcttc 561
Query: 1019 aggagcccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctc 1078
| | ||||| |||||||||||||| |||||||| ||| |||| | || || ||||||
Sbjct: 560 aataaaccatttcggcgcttgcagaaagtgacctgtcggttcgtagtattttcaatcctc 501
Query: 1079 ttgatctcaatc 1090
|| |||||||||
Sbjct: 500 tttatctcaatc 489
>gb|AF023615.1|AF023615 Pinus radiata MADS box protein mRNA, complete cds
Length = 922
Score = 56.0 bits (28), Expect = 4e-006
Identities = 106/132 (80%)
Strand = Plus / Minus
Query: 959 gagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtacgccttcttg 1018
|||||||||||||||||||| || || || || || || || | || |||||||||||
Sbjct: 159 gagaagacgatgagggccacttctgcatcacaaagaactgataattcatacgccttcttt 100
Query: 1019 aggagcccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctc 1078
| | ||||| |||||||||||||| |||||||| ||| |||| | || || ||||||
Sbjct: 99 aataaaccatttcggcgcttgcagaaagtgacctgtcggttcgtagtattttcaatcctc 40
Query: 1079 ttgatctcaatc 1090
|| |||||||||
Sbjct: 39 tttatctcaatc 28
>gb|AW010611.1|AW010611 ST08G08 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST08G08, mRNA sequence
Length = 927
Score = 52.0 bits (26), Expect = 5e-005
Identities = 53/62 (85%)
Strand = Plus / Minus
Query: 975 ccacctcagcgtcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggc 1034
|||| ||||| |||||||| || ||||||||||| || ||||| || ||||| |||||||
Sbjct: 230 ccacttcagcatcgcagagcaccgagagctcgtaagctttcttcagcagcccgttgcggc 171
Query: 1035 gc 1036
||
Sbjct: 170 gc 169
>gb|AW754659.1|AW754659 PC04G10 Pine TriplEx pollen cone library Pinus taeda cDNA clone
PC04G10, mRNA sequence
Length = 526
Score = 52.0 bits (26), Expect = 5e-005
Identities = 56/66 (84%)
Strand = Plus / Minus
Query: 1025 ccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatc 1084
||||| |||||||||||||| |||||||| ||| |||| | || || |||||||| |||
Sbjct: 407 ccatttcggcgcttgcagaaagtgacctgtcggttcgtagtattttcaatcctctttatc 348
Query: 1085 tcaatc 1090
||||||
Sbjct: 347 tcaatc 342
>gb|BM134188.1|BM134188 NXLV_017_H01_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_017_H01 5' similar to Arabidopsis thaliana
sequence At2g45660 MADS-box protein (AGL20) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 508
Score = 50.1 bits (25), Expect = 2e-004
Identities = 54/64 (84%)
Strand = Plus / Minus
Query: 975 ccacctcagcgtcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggc 1034
|||| ||||| |||||||| || |||||| |||| || ||||| || ||||| |||||||
Sbjct: 404 ccacttcagcatcgcagagcaccgagagcncgtaagctttcttcagcagcccgttgcggc 345
Query: 1035 gctt 1038
||||
Sbjct: 344 gctt 341
>gb|CF386447.1|CF386447 RTDR1_14_B10.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_14_B10_A015 5', mRNA
sequence
Length = 821
Score = 48.1 bits (24), Expect = 9e-004
Identities = 54/64 (84%)
Strand = Plus / Minus
Query: 975 ccacctcagcgtcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggc 1034
|||| ||||| |||||||| || |||||||| || || ||||| || ||||| |||||||
Sbjct: 361 ccacttcagcatcgcagagcaccgagagctcctaagctttcttcagcagcccgttgcggc 302
Query: 1035 gctt 1038
||||
Sbjct: 301 gctt 298
>gb|CF394057.1|CF394057 RTDS2_3_D04.b1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_3_D04_A021 3', mRNA sequence
Length = 611
Score = 48.1 bits (24), Expect = 9e-004
Identities = 48/56 (85%)
Strand = Plus / Plus
Query: 1031 cggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatctc 1086
||||||||||||||||| ||||||| | | | ||||||||||| ||||||||||
Sbjct: 404 cggcgcttgcagaaggtcacctgcctgtgcacgctgttctcgatcttcttgatctc 459
>gb|CF668263.1|CF668263 RTCNT1_35_A03.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_35_A03_A029 5', mRNA sequence
Length = 764
Score = 48.1 bits (24), Expect = 9e-004
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 1031 cggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatctc 1086
||||||||||||||||| ||||||| | | | ||||||||||| ||||||||||
Sbjct: 459 cggcgcttgcagaaggtcacctgcctgtgcacgctgttctcgatcttcttgatctc 404
>gb|CO200411.1|CO200411 GEO2_7_G03.b1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_7_G03_A032 3', mRNA sequence
Length = 860
Score = 48.1 bits (24), Expect = 9e-004
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 1031 cggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatctc 1086
||||||||||||||||| ||||||| | | | ||||||||||| ||||||||||
Sbjct: 237 cggcgcttgcagaaggtcacctgcctgtgcacgctgttctcgatcttcttgatctc 182
>gb|CO200495.1|CO200495 GEO2_7_G03.g1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_7_G03_A032 5', mRNA sequence
Length = 820
Score = 48.1 bits (24), Expect = 9e-004
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 1031 cggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatctc 1086
||||||||||||||||| ||||||| | | | ||||||||||| ||||||||||
Sbjct: 480 cggcgcttgcagaaggtcacctgcctgtgcacgctgttctcgatcttcttgatctc 425
>gb|CO201105.1|CO201105 RTCNT2_3_D12.g1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_3_D12_A029 5', mRNA sequence
Length = 758
Score = 48.1 bits (24), Expect = 9e-004
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 1031 cggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatctc 1086
||||||||||||||||| ||||||| | | | ||||||||||| ||||||||||
Sbjct: 266 cggcgcttgcagaaggtcacctgcctgtgcacgctgttctcgatcttcttgatctc 211
>gb|CO361066.1|CO361066 NDL2_2_B04.g1_A029 Needles control 2 Pinus taeda cDNA clone
NDL2_2_B04_A029 5', mRNA sequence
Length = 840
Score = 48.1 bits (24), Expect = 9e-004
Identities = 54/64 (84%)
Strand = Plus / Minus
Query: 975 ccacctcagcgtcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggc 1034
|||| ||||| |||||||| || |||||||| || || ||||| || ||||| |||||||
Sbjct: 277 ccacttcagcatcgcagagcaccgagagctcctaagctttcttcagcagcccgttgcggc 218
Query: 1035 gctt 1038
||||
Sbjct: 217 gctt 214
>gb|CO364847.1|CO364847 RTK1_22_D10.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_22_D10_A029 3', mRNA sequence
Length = 867
Score = 48.1 bits (24), Expect = 9e-004
Identities = 48/56 (85%)
Strand = Plus / Plus
Query: 1031 cggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatctc 1086
||||||||||||||||| ||||||| | | | ||||||||||| ||||||||||
Sbjct: 574 cggcgcttgcagaaggtcacctgcctgtgcacgctgttctcgatcttcttgatctc 629
>gb|CV031753.1|CV031753 RTNACL1_3_B05.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_3_B05_A029 5', mRNA sequence
Length = 851
Score = 48.1 bits (24), Expect = 9e-004
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 1031 cggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatctc 1086
||||||||||||||||| ||||||| | | | ||||||||||| ||||||||||
Sbjct: 252 cggcgcttgcagaaggtcacctgcctgtgcacgctgttctcgatcttcttgatctc 197
>gb|DR058437.1|DR058437 RTNIT1_11_F11.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_11_F11_A029 5', mRNA sequence
Length = 795
Score = 48.1 bits (24), Expect = 9e-004
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 1031 cggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatctc 1086
||||||||||||||||| ||||||| | | | ||||||||||| ||||||||||
Sbjct: 274 cggcgcttgcagaaggtcacctgcctgtgcacgctgttctcgatcttcttgatctc 219
>gb|DR081124.1|DR081124 RTFEPL1_27_C11.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_27_C11_A029 5', mRNA sequence
Length = 407
Score = 48.1 bits (24), Expect = 9e-004
Identities = 75/92 (81%)
Strand = Plus / Minus
Query: 986 tcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggcgcttgcagaag 1045
|||||||| || |||||||| || || ||||| || | |||||| | |||||| | ||
Sbjct: 195 tcgcagagcacagagagctcataagctttcttcagtaacccattcctgcgcttagaaaac 136
Query: 1046 gtgacctgccggctcgtgttgttctcgatcct 1077
|| ||||||| |||||||| ||||||||||||
Sbjct: 135 gtaacctgcctgctcgtgtcgttctcgatcct 104
>gb|DR178004.1|DR178004 RTMNUT1_8_E05.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_8_E05_A029 5', mRNA sequence
Length = 779
Score = 48.1 bits (24), Expect = 9e-004
Identities = 48/56 (85%)
Strand = Plus / Minus
Query: 1031 cggcgcttgcagaaggtgacctgccggctcgtgttgttctcgatcctcttgatctc 1086
||||||||||||||||| ||||||| | | | ||||||||||| ||||||||||
Sbjct: 338 cggcgcttgcagaaggtcacctgcctgtgcacgctgttctcgatcttcttgatctc 283
>gb|U90344.1|PRU90344 Pinus radiata putative MADS box transcription factor PrMADS9 mRNA,
complete cds
Length = 1038
Score = 48.1 bits (24), Expect = 9e-004
Identities = 75/92 (81%)
Strand = Plus / Minus
Query: 986 tcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggcgcttgcagaag 1045
|||||||| || |||||||| || || ||||| || | |||||| | |||||| | ||
Sbjct: 237 tcgcagagcacagagagctcataagctttcttcagtaacccattcctgcgcttagaaaac 178
Query: 1046 gtgacctgccggctcgtgttgttctcgatcct 1077
|| ||||||| |||||||| ||||||||||||
Sbjct: 177 gtaacctgcctgctcgtgtcgttctcgatcct 146
>gb|CF388137.1|CF388137 RTDR2_1_D05.b1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_1_D05_A021 3', mRNA sequence
Length = 532
Score = 44.1 bits (22), Expect = 0.013
Identities = 115/146 (78%)
Strand = Plus / Plus
Query: 950 ccacggctagagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtac 1009
|||||| | ||||||| ||||| |||||||| || ||||| || || || || || |||
Sbjct: 279 ccacggttggagaagatgatgactgccacctccgcatcgcaaagaacagacagttcatac 338
Query: 1010 gccttcttgaggagcccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttc 1069
|||||||| || | |||||| || |||||| |||| || || ||||| | || | |||
Sbjct: 339 gccttctttagcaacccatttcgacgcttggagaaagtcacttgccgatttgtagtattc 398
Query: 1070 tcgatcctcttgatctcaatccttcc 1095
||||||| ||| ||||||||| ||||
Sbjct: 399 tcgatccgctttatctcaatctttcc 424
>gb|CF389852.1|CF389852 RTDR2_11_B08.b1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_11_B08_A021 3', mRNA
sequence
Length = 685
Score = 44.1 bits (22), Expect = 0.013
Identities = 115/146 (78%)
Strand = Plus / Plus
Query: 950 ccacggctagagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtac 1009
|||||| | ||||||| ||||| |||||||| || ||||| || || || || || |||
Sbjct: 342 ccacggttggagaagatgatgactgccacctccgcatcgcaaagaacagacagttcatac 401
Query: 1010 gccttcttgaggagcccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttc 1069
|||||||| || | |||||| || |||||| |||| || || ||||| | || | |||
Sbjct: 402 gccttctttagcaacccatttcgacgcttggagaaagtcacttgccgatttgtagtattc 461
Query: 1070 tcgatcctcttgatctcaatccttcc 1095
||||||| ||| ||||||||| ||||
Sbjct: 462 tcgatccgctttatctcaatctttcc 487
>gb|CF389963.1|CF389963 RTDR2_11_B08.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_11_B08_A021 5', mRNA
sequence
Length = 791
Score = 44.1 bits (22), Expect = 0.013
Identities = 115/146 (78%)
Strand = Plus / Plus
Query: 950 ccacggctagagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtac 1009
|||||| | ||||||| ||||| |||||||| || ||||| || || || || || |||
Sbjct: 625 ccacggttggagaagatgatgactgccacctccgcatcgcaaagaacagacagttcatac 684
Query: 1010 gccttcttgaggagcccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttc 1069
|||||||| || | |||||| || |||||| |||| || || ||||| | || | |||
Sbjct: 685 gccttctttagcaacccatttcgacgcttggagaaagtcacttgccgatttgtagtattc 744
Query: 1070 tcgatcctcttgatctcaatccttcc 1095
||||||| ||| ||||||||| ||||
Sbjct: 745 tcgatccgctttatctcaatctttcc 770
>gb|CO161503.1|CO161503 FLD1_29_F09.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_29_F09_A029 3', mRNA sequence
Length = 896
Score = 44.1 bits (22), Expect = 0.013
Identities = 115/146 (78%)
Strand = Plus / Minus
Query: 950 ccacggctagagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtac 1009
|||||| | ||||||| ||||| |||||||| || ||||| || || || || || |||
Sbjct: 341 ccacggttggagaagatgatgactgccacctccgcatcgcaaagaacagacagttcatac 282
Query: 1010 gccttcttgaggagcccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttc 1069
|||||||| || | |||||| || |||||| |||| || || ||||| | || | |||
Sbjct: 281 gccttctttagcaacccatttcgacgcttggagaaagtcacttgccgatttgtagtattc 222
Query: 1070 tcgatcctcttgatctcaatccttcc 1095
||||||| ||| ||||||||| ||||
Sbjct: 221 tcgatccgctttatctcaatctttcc 196
>gb|CO161575.1|CO161575 FLD1_29_F09.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_29_F09_A029 5', mRNA sequence
Length = 909
Score = 44.1 bits (22), Expect = 0.013
Identities = 115/146 (78%)
Strand = Plus / Minus
Query: 950 ccacggctagagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtac 1009
|||||| | ||||||| ||||| |||||||| || ||||| || || || || || |||
Sbjct: 344 ccacggttggagaagatgatgactgccacctccgcatcgcaaagaacagacagttcatac 285
Query: 1010 gccttcttgaggagcccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttc 1069
|||||||| || | |||||| || |||||| |||| || || ||||| | || | |||
Sbjct: 284 gccttctttagcaacccatttcgacgcttggagaaagtcacttgccgatttgtagtattc 225
Query: 1070 tcgatcctcttgatctcaatccttcc 1095
||||||| ||| ||||||||| ||||
Sbjct: 224 tcgatccgctttatctcaatctttcc 199
>gb|CX713803.1|CX713803 RTPQ1_13_F12.b1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_13_F12_A032 3', mRNA sequence
Length = 586
Score = 44.1 bits (22), Expect = 0.013
Identities = 115/146 (78%)
Strand = Plus / Plus
Query: 950 ccacggctagagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtac 1009
|||||| | ||||||| ||||| |||||||| || ||||| || || || || || |||
Sbjct: 328 ccacggttggagaagatgatgactgccacctccgcatcgcaaagaacagacagttcatac 387
Query: 1010 gccttcttgaggagcccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttc 1069
|||||||| || | |||||| || |||||| |||| || || ||||| | || | |||
Sbjct: 388 gccttctttagcaacccatttcgacgcttggagaaagtcacttgccgatttgtagtattc 447
Query: 1070 tcgatcctcttgatctcaatccttcc 1095
||||||| ||| ||||||||| ||||
Sbjct: 448 tcgatccgctttatctcaatctttcc 473
>gb|DR013883.1|DR013883 HEAT1_22_D05.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_22_D05_A029 3', mRNA sequence
Length = 705
Score = 44.1 bits (22), Expect = 0.013
Identities = 115/146 (78%)
Strand = Plus / Plus
Query: 950 ccacggctagagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtac 1009
|||||| | ||||||| ||||| |||||||| || ||||| || || || || || |||
Sbjct: 407 ccacggttggagaagatgatgactgccacctccgcatcgcaaagaacagacagttcatac 466
Query: 1010 gccttcttgaggagcccattgcggcgcttgcagaaggtgacctgccggctcgtgttgttc 1069
|||||||| || | |||||| || |||||| |||| || || ||||| | || | |||
Sbjct: 467 gccttctttagcaacccatttcgacgcttggagaaagtcacttgccgatttgtagtattc 526
Query: 1070 tcgatcctcttgatctcaatccttcc 1095
||||||| ||| ||||||||| ||||
Sbjct: 527 tcgatccgctttatctcaatctttcc 552
>gb|CF665739.1|CF665739 RTCNT1_18_D05.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_18_D05_A029 3', mRNA sequence
Length = 665
Score = 42.1 bits (21), Expect = 0.053
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 959 gagaagacgatgagggccacctcagcgtcgcagagga 995
||||||||||| |||||||| || |||||||| ||||
Sbjct: 346 gagaagacgatcagggccacttccgcgtcgcacagga 382
>gb|CV033251.1|CV033251 RTNACL1_33_G03.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_33_G03_A029 3', mRNA sequence
Length = 839
Score = 42.1 bits (21), Expect = 0.053
Identities = 56/68 (82%)
Strand = Plus / Minus
Query: 950 ccacggctagagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtac 1009
|||||||| ||||||||||||| || || || |||||||| || || || ||||| |||
Sbjct: 107 ccacggcttgagaagacgatgaccgcgacttctgcgtcgcanagcacagacagctcatac 48
Query: 1010 gccttctt 1017
|| |||||
Sbjct: 47 gctttctt 40
>gb|DR167777.1|DR167777 RTPHOS1_21_A12.b1_A029 Roots minus phosphorous Pinus taeda cDNA clone
RTPHOS1_21_A12_A029 3', mRNA sequence
Length = 628
Score = 42.1 bits (21), Expect = 0.053
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 1067 ttctcgatcctcttgatctcaatccttcc 1095
|||||||||| ||||||||||||| ||||
Sbjct: 284 ttctcgatccgcttgatctcaatctttcc 312
>gb|BG318417.1|BG318417 NXPV_013_D07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_013_D07 5' similar to Arabidopsis
thaliana sequence At2g45660 MADS-box protein (AGL20) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 577
Score = 40.1 bits (20), Expect = 0.21
Identities = 74/92 (80%)
Strand = Plus / Minus
Query: 986 tcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggcgcttgcagaag 1045
|||||||| || |||||||| || || ||||| || | |||||| | |||||| | ||
Sbjct: 237 tcgcagagcacagagagctcataagctttcttcagtaacccattcctgcgcttagaaaac 178
Query: 1046 gtgacctgccggctcgtgttgttctcgatcct 1077
|| ||||||| |||||| | ||||||||||||
Sbjct: 177 gtaacctgcctgctcgtatcgttctcgatcct 146
>gb|BG625803.1|BG625803 NXPV_066_C06_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_066_C06 5' similar to Arabidopsis
thaliana sequence At2g45660 MADS-box protein (AGL20) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 428
Score = 40.1 bits (20), Expect = 0.21
Identities = 74/92 (80%)
Strand = Plus / Minus
Query: 986 tcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggcgcttgcagaag 1045
|||||||| || |||||||| || || ||||| || | |||||| | |||||| | ||
Sbjct: 237 tcgcagagcacagagagctcataagctttcttcagtaacccattcctgcgcttagaaaac 178
Query: 1046 gtgacctgccggctcgtgttgttctcgatcct 1077
|| ||||||| |||||| | ||||||||||||
Sbjct: 177 gtaacctgcctgctcgtatcgttctcgatcct 146
>gb|CF385287.1|CF385287 RTDR1_3_B08.b1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_3_B08_A015 3', mRNA
sequence
Length = 559
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 865 cccagaggaagagccaacgg 884
||||||||||||||||||||
Sbjct: 246 cccagaggaagagccaacgg 227
>gb|CF385426.1|CF385426 RTDR1_3_B08.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_3_B08_A015 5', mRNA
sequence
Length = 792
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 865 cccagaggaagagccaacgg 884
||||||||||||||||||||
Sbjct: 784 cccagaggaagagccaacgg 765
>gb|CF471239.1|CF471239 RTDS1_2_F01.b1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_2_F01_A015 3', mRNA sequence
Length = 635
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 865 cccagaggaagagccaacgg 884
||||||||||||||||||||
Sbjct: 304 cccagaggaagagccaacgg 285
>gb|CF471300.1|CF471300 RTDS1_2_F01.g1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_2_F01_A015 5', mRNA sequence
Length = 681
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 865 cccagaggaagagccaacgg 884
||||||||||||||||||||
Sbjct: 351 cccagaggaagagccaacgg 332
>gb|CF472866.1|CF472866 RTDS1_12_A11.b1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_12_A11_A015 3', mRNA sequence
Length = 584
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 865 cccagaggaagagccaacgg 884
||||||||||||||||||||
Sbjct: 256 cccagaggaagagccaacgg 237
>gb|CF475501.1|CF475501 RTWW2_12_G12.g1_A021 Well-watered loblolly pine roots WW2 Pinus taeda
cDNA clone RTWW2_12_G12_A021 5', mRNA sequence
Length = 779
Score = 40.1 bits (20), Expect = 0.21
Identities = 74/92 (80%)
Strand = Plus / Minus
Query: 986 tcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggcgcttgcagaag 1045
|||||||| || |||||||| || || ||||| || | |||||| | |||||| | ||
Sbjct: 186 tcgcagagcacagagagctcataagctttcttcagtaacccattcctgcgcttagaaaac 127
Query: 1046 gtgacctgccggctcgtgttgttctcgatcct 1077
|| ||||||| |||||| | ||||||||||||
Sbjct: 126 gtaacctgcctgctcgtatcgttctcgatcct 95
>gb|CO199860.1|CO199860 GEO2_4_A06.b1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_4_A06_A032 3', mRNA sequence
Length = 836
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 865 cccagaggaagagccaacgg 884
||||||||||||||||||||
Sbjct: 17 cccagaggaagagccaacgg 36
>gb|CV033324.1|CV033324 RTNACL1_33_G03.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_33_G03_A029 5', mRNA sequence
Length = 796
Score = 40.1 bits (20), Expect = 0.21
Identities = 56/68 (82%)
Strand = Plus / Minus
Query: 950 ccacggctagagaagacgatgagggccacctcagcgtcgcagaggacggagagctcgtac 1009
|||||||| ||||||||||||| || || || |||||||| || || || ||||| |||
Sbjct: 323 ccacggcttgagaagacgatgaccgcgacttctgcgtcgcaaagcacagacagctcatac 264
Query: 1010 gccttctt 1017
|| |||||
Sbjct: 263 gctttctt 256
>gb|DR112977.1|DR112977 RTS1_32_C04.b1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_32_C04_A029 3', mRNA sequence
Length = 503
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 959 gagaagacgatgagggccacctcagcgtcgca 990
||||||||||| | |||||| |||||||||||
Sbjct: 197 gagaagacgattaaggccacttcagcgtcgca 228
>gb|DR384822.1|DR384822 RTHG1_4_G03.g1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_4_G03_A029 5', mRNA sequence
Length = 668
Score = 40.1 bits (20), Expect = 0.21
Identities = 74/92 (80%)
Strand = Plus / Minus
Query: 986 tcgcagaggacggagagctcgtacgccttcttgaggagcccattgcggcgcttgcagaag 1045
|||||||| || |||||||| || || ||||| || | |||||| | |||||| | ||
Sbjct: 237 tcgcagagcacagagagctcataagctttcttcagtaacccattcctgcgcttagaaaac 178
Query: 1046 gtgacctgccggctcgtgttgttctcgatcct 1077
|| ||||||| |||||| | ||||||||||||
Sbjct: 177 gtaacctgcctgctcgtatcgttctcgatcct 146
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 169,003
Number of Sequences: 355925
Number of extensions: 169003
Number of successful extensions: 51050
Number of sequences better than 0.5: 44
Number of HSP's better than 0.5 without gapping: 37
Number of HSP's successfully gapped in prelim test: 7
Number of HSP's that attempted gapping in prelim test: 50981
Number of HSP's gapped (non-prelim): 67
length of query: 1221
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1202
effective length of database: 210,514,662
effective search space: 253038623724
effective search space used: 253038623724
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)