BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 7297169.2.1
(545 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX249681.1|BX249681 BX249681 Pinus pinaster differenciat... 54 6e-006
gb|CF386604.1|CF386604 RTDR1_15_E07.g1_A015 Loblolly pine r... 46 0.001
gb|CF391866.1|CF391866 RTDR3_10_D08.g1_A022 Loblolly pine r... 46 0.001
gb|CF401023.1|CF401023 RTWW1_9_G01.g1_A015 Well-watered lob... 46 0.001
gb|CN783734.1|CN783734 EST782425 Sequencing ESTs from loblo... 46 0.001
gb|CO411566.1|CO411566 EST841951 Sequencing ESTs from loblo... 46 0.001
gb|CO412398.1|CO412398 EST842783 Sequencing ESTs from loblo... 46 0.001
gb|CO414603.1|CO414603 EST844988 Sequencing ESTs from loblo... 46 0.001
gb|CV144450.1|CV144450 EST855659 Sequencing ESTs from loblo... 46 0.001
gb|CV146360.1|CV146360 EST857569 Sequencing ESTs from loblo... 46 0.001
gb|DN447351.1|DN447351 EST943150 Sequencing ESTs from loblo... 46 0.001
gb|DN449602.1|DN449602 EST945401 Sequencing ESTs from loblo... 46 0.001
gb|DN453469.1|DN453469 EST949268 Sequencing ESTs from loblo... 46 0.001
gb|DN455969.1|DN455969 EST951768 Sequencing ESTs from loblo... 46 0.001
gb|DN458466.1|DN458466 EST954265 Sequencing ESTs from loblo... 46 0.001
gb|DN459174.1|DN459174 EST954973 Sequencing ESTs from loblo... 46 0.001
gb|DN464364.1|DN464364 EST960163 Sequencing ESTs from loblo... 46 0.001
gb|DR019118.1|DR019118 STRS1_27_H10.g1_A034 Shoot tip pitch... 46 0.001
gb|DR118515.1|DR118515 RTMG1_17_B05.g1_A029 Roots minus mag... 46 0.001
gb|DR692783.1|DR692783 EST1082871 Normalized pine embryo li... 46 0.001
gb|DT625556.1|DT625556 EST1157480 Sequencing ESTs from lobl... 46 0.001
gb|DT626828.1|DT626828 EST1159904 Sequencing ESTs from lobl... 46 0.001
gb|BE643663.1|BE643663 NXCI_041_D06_F NXCI (Nsf Xylem Compr... 44 0.006
gb|BE643830.1|BE643830 NXCI_047_G08_F NXCI (Nsf Xylem Compr... 44 0.006
gb|BE657104.1|BE657104 NXCI_042_G04_F NXCI (Nsf Xylem Compr... 44 0.006
gb|BE761954.1|BE761954 NXCI_075_C02_F NXCI (Nsf Xylem Compr... 44 0.006
gb|BF220706.1|BF220706 NXCI_149_F02_F NXCI (Nsf Xylem Compr... 44 0.006
gb|BF610596.1|BF610596 NXSI_060_E03_F NXSI (Nsf Xylem Side ... 44 0.006
gb|BG040873.1|BG040873 NXSI_116_B09_F NXSI (Nsf Xylem Side ... 44 0.006
gb|BQ703203.1|BQ703203 NXSI_137_H05_F NXSI (Nsf Xylem Side ... 44 0.006
gb|CF389132.1|CF389132 RTDR2_13_C04.g1_A021 Loblolly pine r... 44 0.006
gb|CF396374.1|CF396374 RTDS2_21_H10.g1_A021 Drought-stresse... 44 0.006
gb|CF401715.1|CF401715 RTWW1_14_H03.g1_A015 Well-watered lo... 44 0.006
gb|CF471972.1|CF471972 RTDS1_7_G09.g1_A015 Drought-stressed... 44 0.006
gb|CF472606.1|CF472606 RTDS1_10_A01.g1_A015 Drought-stresse... 44 0.006
gb|CF479066.1|CF479066 RTWW3_21_B04.g1_A022 Well-watered lo... 44 0.006
gb|CF666491.1|CF666491 RTCNT1_23_E05.g1_A029 Root control P... 44 0.006
gb|BX682475.1|BX682475 BX682475 Pinus pinaster differenciat... 44 0.006
gb|CO165989.1|CO165989 FLD1_58_C01.g1_A029 Root flooded Pin... 44 0.006
gb|CO200548.1|CO200548 GEO2_8_C10.b1_A032 Root gravitropism... 44 0.006
gb|CV135535.1|CV135535 EST846744 Sequencing ESTs from loblo... 44 0.006
gb|CV146601.1|CV146601 EST857810 Sequencing ESTs from loblo... 44 0.006
gb|CV147000.1|CV147000 EST858209 Sequencing ESTs from loblo... 44 0.006
gb|CX648612.1|CX648612 COLD1_29_F08.g1_A029 Root cold Pinus... 44 0.006
gb|DN445702.1|DN445702 EST941501 Sequencing ESTs from loblo... 44 0.006
gb|DN448826.1|DN448826 EST944625 Sequencing ESTs from loblo... 44 0.006
gb|DN452433.1|DN452433 EST948232 Sequencing ESTs from loblo... 44 0.006
gb|DN452691.1|DN452691 EST948490 Sequencing ESTs from loblo... 44 0.006
gb|DN453349.1|DN453349 EST949148 Sequencing ESTs from loblo... 44 0.006
gb|DN456450.1|DN456450 EST952249 Sequencing ESTs from loblo... 44 0.006
gb|DN456576.1|DN456576 EST952375 Sequencing ESTs from loblo... 44 0.006
gb|DN462084.1|DN462084 EST957883 Sequencing ESTs from loblo... 44 0.006
gb|DN463837.1|DN463837 EST959636 Sequencing ESTs from loblo... 44 0.006
gb|DN465331.1|DN465331 EST961130 Sequencing ESTs from loblo... 44 0.006
gb|DR015314.1|DR015314 STRS1_2_F03.g1_A034 Shoot tip pitch ... 44 0.006
gb|DR019144.1|DR019144 STRS1_28_C06.b2_A034 Shoot tip pitch... 44 0.006
gb|DR019221.1|DR019221 STRS1_28_C06.g1_A034 Shoot tip pitch... 44 0.006
gb|DR047483.1|DR047483 RTBOR1_1_G09.b1_A029 Roots plus adde... 44 0.006
gb|DR120066.1|DR120066 RTMG1_27_G08.b1_A029 Roots minus mag... 44 0.006
gb|DR689559.1|DR689559 EST1079645 Normalized pine embryo li... 44 0.006
gb|DT625257.1|DT625257 EST1159532 Sequencing ESTs from lobl... 44 0.006
gb|DT625286.1|DT625286 EST1159561 Sequencing ESTs from lobl... 44 0.006
gb|CF385188.1|CF385188 RTDR1_2_B01.g1_A015 Loblolly pine ro... 42 0.023
gb|CO366148.1|CO366148 RTK1_26_D11.b1_A029 Roots minus pota... 42 0.023
gb|CO366233.1|CO366233 RTK1_26_D11.g1_A029 Roots minus pota... 42 0.023
gb|DR384606.1|DR384606 RTHG1_3_H01.b1_A029 Roots plus added... 42 0.023
gb|BF010640.1|BF010640 NXCI_087_D06_F NXCI (Nsf Xylem Compr... 40 0.091
gb|DN463937.1|DN463937 EST959736 Sequencing ESTs from loblo... 40 0.091
gb|DR019031.1|DR019031 STRS1_27_H10.b1_A034 Shoot tip pitch... 40 0.091
gb|DT627466.1|DT627466 EST1160542 Sequencing ESTs from lobl... 40 0.091
gb|BX677610.1|BX677610 BX677610 RN Pinus pinaster cDNA clon... 38 0.36
gb|CO369130.1|CO369130 RTK1_45_D09.b1_A029 Roots minus pota... 38 0.36
gb|DR080121.1|DR080121 RTFEPL1_20_A04.g1_A029 Roots plus ad... 38 0.36
gb|DR102107.1|DR102107 STRR1_78_B06.g1_A033 Stem Response R... 38 0.36
>gb|BX249681.1|BX249681 BX249681 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP027A11, mRNA sequence
Length = 678
Score = 54.0 bits (27), Expect = 6e-006
Identities = 63/75 (84%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
||||||||||| |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 368 gcgcacccggactggagcccagcggcaattcggtccgcactcatgaccactgcatacacc 427
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 428 gtggacaactccggg 442
>gb|CF386604.1|CF386604 RTDR1_15_E07.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_15_E07_A015 5', mRNA
sequence
Length = 738
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 401 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 460
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 461 gtggacaactccggg 475
>gb|CF391866.1|CF391866 RTDR3_10_D08.g1_A022 Loblolly pine roots recovering from drought
DR3 Pinus taeda cDNA clone RTDR3_10_D08_A022 5', mRNA
sequence
Length = 858
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 116 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 175
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 176 gtggacaactccggg 190
>gb|CF401023.1|CF401023 RTWW1_9_G01.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_9_G01_A015 5', mRNA sequence
Length = 752
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 63 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 122
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 123 gtggacaactccggg 137
>gb|CN783734.1|CN783734 EST782425 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAAC41 5' end, mRNA sequence
Length = 987
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 211 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 270
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 271 gtggacaactccggg 285
>gb|CO411566.1|CO411566 EST841951 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIALL89 5' end, mRNA sequence
Length = 840
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 49 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 108
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 109 gtggacaactccggg 123
>gb|CO412398.1|CO412398 EST842783 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIALW77 5' end, mRNA sequence
Length = 888
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 49 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 108
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 109 gtggacaactccggg 123
>gb|CO414603.1|CO414603 EST844988 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAMQ58 5' end, mRNA sequence
Length = 888
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 49 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 108
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 109 gtggacaactccggg 123
>gb|CV144450.1|CV144450 EST855659 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPID577 5' end, mRNA sequence
Length = 879
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 164 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 223
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 224 gtggacaactccggg 238
>gb|CV146360.1|CV146360 EST857569 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIDV51 5' end, mRNA sequence
Length = 813
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 668 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 727
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 728 gtggacaactccggg 742
>gb|DN447351.1|DN447351 EST943150 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIBR94 5' end, mRNA sequence
Length = 888
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 49 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 108
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 109 gtggacaactccggg 123
>gb|DN449602.1|DN449602 EST945401 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPICJ66 5' end, mRNA sequence
Length = 871
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 306 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 365
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 366 gtggacaactccggg 380
>gb|DN453469.1|DN453469 EST949268 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIFT16 5' end, mRNA sequence
Length = 861
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 280 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 339
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 340 gtggacaactccggg 354
>gb|DN455969.1|DN455969 EST951768 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIGJ95 5' end, mRNA sequence
Length = 886
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 457 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 516
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 517 gtggacaactccggg 531
>gb|DN458466.1|DN458466 EST954265 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIHC25 5' end, mRNA sequence
Length = 810
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 345 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 404
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 405 gtggacaactccggg 419
>gb|DN459174.1|DN459174 EST954973 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIHK20 5' end, mRNA sequence
Length = 1009
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 170 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 229
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 230 gtggacaactccggg 244
>gb|DN464364.1|DN464364 EST960163 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIJA87 5' end, mRNA sequence
Length = 849
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 250 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 309
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 310 gtggacaactccggg 324
>gb|DR019118.1|DR019118 STRS1_27_H10.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_27_H10_A034 5', mRNA sequence
Length = 763
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 258 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 317
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 318 gtggacaactccggg 332
>gb|DR118515.1|DR118515 RTMG1_17_B05.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_17_B05_A029 5', mRNA sequence
Length = 678
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 207 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 266
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 267 gtggacaactccggg 281
>gb|DR692783.1|DR692783 EST1082871 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWADQ33 3' end, mRNA sequence
Length = 790
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 481 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 540
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 541 gtggacaactccggg 555
>gb|DT625556.1|DT625556 EST1157480 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIMA125 5' end, mRNA sequence
Length = 930
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 211 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 270
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 271 gtggacaactccggg 285
>gb|DT626828.1|DT626828 EST1159904 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIMAR79 5' end, mRNA sequence
Length = 959
Score = 46.1 bits (23), Expect = 0.001
Identities = 62/75 (82%)
Strand = Plus / Plus
Query: 352 gcgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaac 411
|||||||| || |||||||| ||||| || ||| || ||||||||||| || |||| |
Sbjct: 170 gcgcaccccgactggagcccagcggccattcggtccgcactcatgaccactgcatacacc 229
Query: 412 ctggacaactccggg 426
||||||||||||||
Sbjct: 230 gtggacaactccggg 244
>gb|BE643663.1|BE643663 NXCI_041_D06_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_041_D06 5' similar to Arabidopsis
thaliana sequence At2g05920 serine protease like protein
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 315
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 143 tggagccccgccgccataaaatcggcgctcatgaccac 180
>gb|BE643830.1|BE643830 NXCI_047_G08_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_047_G08 5' similar to Arabidopsis
thaliana sequence At2g05920 serine protease like protein
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 251
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 143 tggagccccgccgccataaaatcggcgctcatgaccac 180
>gb|BE657104.1|BE657104 NXCI_042_G04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_042_G04 5' similar to Arabidopsis
thaliana sequence At2g05920 serine protease like protein
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 268
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 160 tggagccccgccgccataaaatcggcgctcatgaccac 197
>gb|BE761954.1|BE761954 NXCI_075_C02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_075_C02 5' similar to Arabidopsis
thaliana sequence At2g05920 serine protease like protein
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 390
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 249 tggagccccgccgccataaaatcggcgctcatgaccac 286
>gb|BF220706.1|BF220706 NXCI_149_F02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_149_F02 5' similar to Arabidopsis
thaliana sequence At2g05920 serine protease like protein
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 542
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 143 tggagccccgccgccataaaatcggcgctcatgaccac 180
>gb|BF610596.1|BF610596 NXSI_060_E03_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_060_E03 5' similar to Arabidopsis thaliana
sequence At5g67360 cucumisin-like serine protease
(gb|AAC18851.1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 396
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 123 tggagccccgccgccataaaatcggcgctcatgaccac 160
>gb|BG040873.1|BG040873 NXSI_116_B09_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_116_B09 5' similar to Arabidopsis thaliana
sequence At2g05920 serine protease like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 552
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 102 tggagccccgccgccataaaatcggcgctcatgaccac 139
>gb|BQ703203.1|BQ703203 NXSI_137_H05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_137_H05 5' similar to Arabidopsis thaliana
sequence At2g05920 serine protease like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 558
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 102 tggagccccgccgccataaaatcggcgctcatgaccac 139
>gb|CF389132.1|CF389132 RTDR2_13_C04.g1_A021 Loblolly pine roots recovering from drought
DR2 Pinus taeda cDNA clone RTDR2_13_C04_A021 5', mRNA
sequence
Length = 704
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 86 tggagccccgccgccataaaatcggcgctcatgaccac 123
>gb|CF396374.1|CF396374 RTDS2_21_H10.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_21_H10_A021 5', mRNA sequence
Length = 743
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 325 tggagccccgccgccataaaatcggcgctcatgaccac 362
>gb|CF401715.1|CF401715 RTWW1_14_H03.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_14_H03_A015 5', mRNA sequence
Length = 795
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 179 tggagccccgccgccataaaatcggcgctcatgaccac 216
>gb|CF471972.1|CF471972 RTDS1_7_G09.g1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_7_G09_A015 5', mRNA sequence
Length = 763
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 674 tggagccccgccgccataaaatcggcgctcatgaccac 711
>gb|CF472606.1|CF472606 RTDS1_10_A01.g1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_10_A01_A015 5', mRNA sequence
Length = 693
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 206 tggagccccgccgccataaaatcggcgctcatgaccac 243
>gb|CF479066.1|CF479066 RTWW3_21_B04.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_21_B04_A022 5', mRNA sequence
Length = 732
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 272 tggagccccgccgccataaaatcggcgctcatgaccac 309
>gb|CF666491.1|CF666491 RTCNT1_23_E05.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_23_E05_A029 5', mRNA sequence
Length = 727
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 621 tggagccccgccgccataaaatcggcgctcatgaccac 658
>gb|BX682475.1|BX682475 BX682475 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 117B06 similar to serine protease, mRNA
sequence
Length = 584
Score = 44.1 bits (22), Expect = 0.006
Identities = 61/74 (82%)
Strand = Plus / Plus
Query: 353 cgcacccggagtggagccccgcggcgatcaagtcggcgctcatgaccacggcgtacaacc 412
||||||||||||||||||| || || || ||| || ||||||||||| || |||| |
Sbjct: 1 cgcacccggagtggagcccagccgcaattcggtccgcactcatgaccactgcatacaccg 60
Query: 413 tggacaactccggg 426
||||||| ||||||
Sbjct: 61 tggacaattccggg 74
>gb|CO165989.1|CO165989 FLD1_58_C01.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_58_C01_A029 5', mRNA sequence
Length = 786
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 220 tggagccccgccgccataaaatcggcgctcatgaccac 257
>gb|CO200548.1|CO200548 GEO2_8_C10.b1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_8_C10_A032 3', mRNA sequence
Length = 897
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 596 tggagccccgccgccataaaatcggcgctcatgaccac 559
>gb|CV135535.1|CV135535 EST846744 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PICMD22 5' end, mRNA sequence
Length = 872
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 225 tggagccccgccgccataaaatcggcgctcatgaccac 262
>gb|CV146601.1|CV146601 EST857810 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIDY24 5' end, mRNA sequence
Length = 861
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 28 tggagccccgccgccataaaatcggcgctcatgaccac 65
>gb|CV147000.1|CV147000 EST858209 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIE262 5' end, mRNA sequence
Length = 981
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 511 tggagccccgccgccataaaatcggcgctcatgaccac 548
>gb|CX648612.1|CX648612 COLD1_29_F08.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_29_F08_A029 5', mRNA sequence
Length = 752
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 632 tggagccccgccgccataaaatcggcgctcatgaccac 669
>gb|DN445702.1|DN445702 EST941501 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIA043 5' end, mRNA sequence
Length = 887
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 476 tggagccccgccgccataaaatcggcgctcatgaccac 513
>gb|DN448826.1|DN448826 EST944625 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIC979 5' end, mRNA sequence
Length = 790
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 282 tggagccccgccgccataaaatcggcgctcatgaccac 319
>gb|DN452433.1|DN452433 EST948232 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIFI07 5' end, mRNA sequence
Length = 808
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 132 tggagccccgccgccataaaatcggcgctcatgaccac 169
>gb|DN452691.1|DN452691 EST948490 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIFK80 5' end, mRNA sequence
Length = 800
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 614 tggagccccgccgccataaaatcggcgctcatgaccac 651
>gb|DN453349.1|DN453349 EST949148 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIFR88 5' end, mRNA sequence
Length = 974
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 185 tggagccccgccgccataaaatcggcgctcatgaccac 222
>gb|DN456450.1|DN456450 EST952249 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIGP14 5' end, mRNA sequence
Length = 951
Score = 44.1 bits (22), Expect = 0.006
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 364 tggagccccgcggcgatcaagtcggcgctcatgaccac 401
||||||||||| || || || |||||||||||||||||
Sbjct: 183 tggagccccgccgccataaaatcggcgctcatgaccac 220
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 28,288
Number of Sequences: 355925
Number of extensions: 28288
Number of successful extensions: 6782
Number of sequences better than 0.5: 74
Number of HSP's better than 0.5 without gapping: 73
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 6680
Number of HSP's gapped (non-prelim): 102
length of query: 545
length of database: 217,277,237
effective HSP length: 19
effective length of query: 526
effective length of database: 210,514,662
effective search space: 110730712212
effective search space used: 110730712212
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)