BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 5705822.3.1
(888 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW010610.1|AW010610 ST08G07 Pine TriplEx shoot tip libra... 40 0.15
>gb|AW010610.1|AW010610 ST08G07 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST08G07, mRNA sequence
Length = 881
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 579 ttttattttgaagttgatga 598
||||||||||||||||||||
Sbjct: 213 ttttattttgaagttgatga 232
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 108,288
Number of Sequences: 355925
Number of extensions: 108288
Number of successful extensions: 32764
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32763
Number of HSP's gapped (non-prelim): 1
length of query: 888
length of database: 217,277,237
effective HSP length: 19
effective length of query: 869
effective length of database: 210,514,662
effective search space: 182937241278
effective search space used: 182937241278
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)