BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 4790360.2.1
         (667 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BQ696389.1|BQ696389  NXPV_040_F05_F NXPV (Nsf Xylem Plani...    52   3e-005
gb|DR694977.1|DR694977  EST1085070 Normalized pine embryo li...    52   3e-005
gb|DT638989.1|DT638989  EST1153920 Normalized pine embryo li...    52   3e-005
gb|BI397792.1|BI397792  NXPV_107_E10_F NXPV (Nsf Xylem Plani...    46   0.002

>gb|BQ696389.1|BQ696389 NXPV_040_F05_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
           cDNA clone NXPV_040_F05 5' similar to Arabidopsis
           thaliana sequence At3g14960 galactosyltransferase,
           putative see http://mips.gsf.de/proj/thal/db/index.html,
           mRNA sequence
          Length = 456

 Score = 52.0 bits (26), Expect = 3e-005
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 122 atgttcagcaacgaggacgttacaattggatcgtggatgcttgctatgaacgtcaaccat 181
           ||||| ||||| || ||||| || |||||  | ||||||||||||||||| |||||||||
Sbjct: 151 atgtttagcaatgaagacgtgaccattggggcatggatgcttgctatgaatgtcaaccat 210

             
Query: 182 ga 183
           ||
Sbjct: 211 ga 212



>gb|DR694977.1|DR694977 EST1085070 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAEJ07 3' end, mRNA sequence
          Length = 793

 Score = 52.0 bits (26), Expect = 3e-005
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 122 atgttcagcaacgaggacgttacaattggatcgtggatgcttgctatgaacgtcaaccat 181
           ||||| ||||| || ||||| || |||||  | ||||||||||||||||| |||||||||
Sbjct: 391 atgtttagcaatgaagacgtgaccattggggcatggatgcttgctatgaatgtcaaccat 450

             
Query: 182 ga 183
           ||
Sbjct: 451 ga 452




 Score = 48.1 bits (24), Expect = 5e-004
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 222 cttcaattgctgtttgggacatcccaaaatgctcaggtct 261
           |||| |||||||| ||||| |||||||| |||||||||||
Sbjct: 491 cttctattgctgtatgggatatcccaaagtgctcaggtct 530



>gb|DT638989.1|DT638989 EST1153920 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMHL79 3' end, mRNA sequence
          Length = 850

 Score = 52.0 bits (26), Expect = 3e-005
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 122 atgttcagcaacgaggacgttacaattggatcgtggatgcttgctatgaacgtcaaccat 181
           ||||| ||||| || ||||| || |||||  | ||||||||||||||||| |||||||||
Sbjct: 399 atgtttagcaatgaagacgtgaccattggggcatggatgcttgctatgaatgtcaaccat 458

             
Query: 182 ga 183
           ||
Sbjct: 459 ga 460




 Score = 48.1 bits (24), Expect = 5e-004
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 222 cttcaattgctgtttgggacatcccaaaatgctcaggtct 261
           |||| |||||||| ||||| |||||||| |||||||||||
Sbjct: 499 cttctattgctgtatgggatatcccaaagtgctcaggtct 538



>gb|BI397792.1|BI397792 NXPV_107_E10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
           cDNA clone NXPV_107_E10 5' similar to Arabidopsis
           thaliana sequence At3g14960 galactosyltransferase,
           putative see http://mips.gsf.de/proj/thal/db/index.html,
           mRNA sequence
          Length = 267

 Score = 46.1 bits (23), Expect = 0.002
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 122 atgttcagcaacgaggacgttacaattggatcgtggatgcttgctatgaacgtcaaccat 181
           ||||| ||||| || ||||| || |||||  | |||||||| |||||||| |||||||||
Sbjct: 158 atgtttagcaatgaagacgtgaccattggggcatggatgctngctatgaatgtcaaccat 217

             
Query: 182 ga 183
           ||
Sbjct: 218 ga 219



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 70,156
Number of Sequences: 355925
Number of extensions: 70156
Number of successful extensions: 18273
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18267
Number of HSP's gapped (non-prelim): 6
length of query: 667
length of database: 217,277,237
effective HSP length: 19
effective length of query: 648
effective length of database: 210,514,662
effective search space: 136413500976
effective search space used: 136413500976
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)