BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3871923.2.1
(1030 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF667687.1|CF667687 RTCNT1_31_H09.g1_A029 Root control P... 72 5e-011
gb|DR686433.1|DR686433 EST1076511 Normalized pine embryo li... 64 1e-008
gb|DR694004.1|DR694004 EST1084094 Normalized pine embryo li... 64 1e-008
gb|DT633478.1|DT633478 EST1148409 Normalized pine embryo li... 64 1e-008
gb|CF672023.1|CF672023 RTCNT1_60_G07.g1_A029 Root control P... 60 2e-007
gb|CF397970.1|CF397970 RTDS3_23_D02.g1_A022 Drought-stresse... 42 0.044
gb|CO361225.1|CO361225 NDL2_3_C05.g1_A029 Needles control 2... 42 0.044
gb|DR056018.1|DR056018 RTCA1_27_C05.g1_A029 Roots minus cal... 42 0.044
gb|DR694755.1|DR694755 EST1084847 Normalized pine embryo li... 42 0.044
gb|DR745433.1|DR745433 RTCU1_29_C03.g1_A029 Roots plus adde... 42 0.044
gb|DT639129.1|DT639129 EST1154060 Normalized pine embryo li... 42 0.044
>gb|CF667687.1|CF667687 RTCNT1_31_H09.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_31_H09_A029 5', mRNA sequence
Length = 797
Score = 71.9 bits (36), Expect = 5e-011
Identities = 87/104 (83%)
Strand = Plus / Plus
Query: 413 agcgttacggtggtcgagagcttgatgatggcgattgccagtgtcattccaaatttcctc 472
|||||||| ||||| ||||| | |||||||| || || ||||| | || || ||||||
Sbjct: 150 agcgttacagtggtggagagtcttatgatggccatagctagtgttgtgccgaacttcctc 209
Query: 473 atgggtatcatcataggggccgggattcagggaatattcatgct 516
|||||||| |||||||| || || ||||||||||||||||||||
Sbjct: 210 atgggtataatcataggtgctggtattcagggaatattcatgct 253
>gb|DR686433.1|DR686433 EST1076511 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABG02 3' end, mRNA sequence
Length = 798
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Plus
Query: 185 ttcatgtccattggaggattcccttcgttcgttgaagaaatgaaggtcttccagcgggaa 244
|||||||||||||||||||||||||| || || || || |||||||| || ||||| |||
Sbjct: 356 ttcatgtccattggaggattcccttcttttgtggaggatatgaaggtttttcagcgtgaa 415
Query: 245 cggctgaacgggcactacgg 264
|| |||| || ||||||||
Sbjct: 416 aggttgaatggacactacgg 435
>gb|DR694004.1|DR694004 EST1084094 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAE690 3' end, mRNA sequence
Length = 760
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Plus
Query: 185 ttcatgtccattggaggattcccttcgttcgttgaagaaatgaaggtcttccagcgggaa 244
|||||||||||||||||||||||||| || || || || |||||||| || ||||| |||
Sbjct: 252 ttcatgtccattggaggattcccttcttttgtggaggatatgaaggtttttcagcgtgaa 311
Query: 245 cggctgaacgggcactacgg 264
|| |||| || ||||||||
Sbjct: 312 aggttgaatggacactacgg 331
>gb|DT633478.1|DT633478 EST1148409 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMFV33 3' end, mRNA sequence
Length = 848
Score = 63.9 bits (32), Expect = 1e-008
Identities = 68/80 (85%)
Strand = Plus / Plus
Query: 185 ttcatgtccattggaggattcccttcgttcgttgaagaaatgaaggtcttccagcgggaa 244
|||||||||||||||||||||||||| || || || || |||||||| || ||||| |||
Sbjct: 364 ttcatgtccattggaggattcccttcttttgtggaggatatgaaggtttttcagcgtgaa 423
Query: 245 cggctgaacgggcactacgg 264
|| |||| || ||||||||
Sbjct: 424 aggttgaatggacactacgg 443
>gb|CF672023.1|CF672023 RTCNT1_60_G07.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_60_G07_A029 5', mRNA sequence
Length = 768
Score = 60.0 bits (30), Expect = 2e-007
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 164 ttcgtctttgggttcgttacgttcatgtccattggaggattcccttcgttcgttgaagaa 223
||||| ||||| |||||||| || ||||||||||| || || || ||||| ||||||||
Sbjct: 431 ttcgtttttggcttcgttacctttatgtccattgggggctttccctcgtttgttgaagat 490
Query: 224 atgaaggtcttccagcgggaacggct 249
|||||||| || ||||| ||| ||||
Sbjct: 491 atgaaggtttttcagcgagaaaggct 516
Score = 42.1 bits (21), Expect = 0.044
Identities = 63/77 (81%)
Strand = Plus / Plus
Query: 413 agcgttacggtggtcgagagcttgatgatggcgattgccagtgtcattccaaatttcctc 472
|||||||| ||||| ||||| | |||||||| || || ||||| | || || ||||||
Sbjct: 680 agcgttacagtggtggagagtcttatgatggccatagctagtgttgtgccgaacttcctc 739
Query: 473 atgggtatcatcatagg 489
|||||||| ||||||||
Sbjct: 740 atgggtataatcatagg 756
>gb|CF397970.1|CF397970 RTDS3_23_D02.g1_A022 Drought-stressed loblolly pine roots DS3 Pinus
taeda cDNA clone RTDS3_23_D02_A022 5', mRNA sequence
Length = 596
Score = 42.1 bits (21), Expect = 0.044
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 195 ttggaggattcccttcgttcg 215
|||||||||||||||||||||
Sbjct: 88 ttggaggattcccttcgttcg 68
>gb|CO361225.1|CO361225 NDL2_3_C05.g1_A029 Needles control 2 Pinus taeda cDNA clone
NDL2_3_C05_A029 5', mRNA sequence
Length = 846
Score = 42.1 bits (21), Expect = 0.044
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 195 ttggaggattcccttcgttcg 215
|||||||||||||||||||||
Sbjct: 120 ttggaggattcccttcgttcg 100
>gb|DR056018.1|DR056018 RTCA1_27_C05.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_27_C05_A029 5', mRNA sequence
Length = 595
Score = 42.1 bits (21), Expect = 0.044
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 195 ttggaggattcccttcgttcg 215
|||||||||||||||||||||
Sbjct: 294 ttggaggattcccttcgttcg 274
>gb|DR694755.1|DR694755 EST1084847 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAEG46 3' end, mRNA sequence
Length = 520
Score = 42.1 bits (21), Expect = 0.044
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 195 ttggaggattcccttcgttcg 215
|||||||||||||||||||||
Sbjct: 29 ttggaggattcccttcgttcg 9
>gb|DR745433.1|DR745433 RTCU1_29_C03.g1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_29_C03_A029 5', mRNA sequence
Length = 607
Score = 42.1 bits (21), Expect = 0.044
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 195 ttggaggattcccttcgttcg 215
|||||||||||||||||||||
Sbjct: 57 ttggaggattcccttcgttcg 37
>gb|DT639129.1|DT639129 EST1154060 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMHN38 3' end, mRNA sequence
Length = 859
Score = 42.1 bits (21), Expect = 0.044
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 195 ttggaggattcccttcgttcg 215
|||||||||||||||||||||
Sbjct: 112 ttggaggattcccttcgttcg 92
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 111,051
Number of Sequences: 355925
Number of extensions: 111051
Number of successful extensions: 26545
Number of sequences better than 0.5: 11
Number of HSP's better than 0.5 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26528
Number of HSP's gapped (non-prelim): 17
length of query: 1030
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1011
effective length of database: 210,514,662
effective search space: 212830323282
effective search space used: 212830323282
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)