BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3829517.2.1
         (913 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CR392991.1|CR392991  CR392991 RN Pinus pinaster cDNA clon...    40   0.16 
gb|DR024662.1|DR024662  STRS1_66_C10.g1_A034 Shoot tip pitch...    40   0.16 
gb|DR685091.1|DR685091  EST1075168 Normalized pine embryo li...    40   0.16 
gb|DT632591.1|DT632591  EST1147522 Normalized pine embryo li...    40   0.16 

>gb|CR392991.1|CR392991 CR392991 RN Pinus pinaster cDNA clone RN51B05, mRNA sequence
          Length = 234

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                      
Query: 29 gactgatgctgtactcgtactggcgcag 56
          |||||| ||||||||| |||||||||||
Sbjct: 51 gactgaagctgtactcttactggcgcag 78



>gb|DR024662.1|DR024662 STRS1_66_C10.g1_A034 Shoot tip pitch canker susceptible Pinus
          taeda cDNA clone STRS1_66_C10_A034 5', mRNA sequence
          Length = 340

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                      
Query: 29 gactgatgctgtactcgtactggcgcag 56
          |||||| ||||||||| |||||||||||
Sbjct: 71 gactgaagctgtactcttactggcgcag 98



>gb|DR685091.1|DR685091 EST1075168 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAAZ95 3' end, mRNA sequence
          Length = 833

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 29  gactgatgctgtactcgtactggcgcag 56
           |||||| ||||||||| |||||||||||
Sbjct: 221 gactgaagctgtactcttactggcgcag 248



>gb|DT632591.1|DT632591 EST1147522 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMFL64 3' end, mRNA sequence
          Length = 865

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 29  gactgatgctgtactcgtactggcgcag 56
           |||||| ||||||||| |||||||||||
Sbjct: 229 gactgaagctgtactcttactggcgcag 256



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 103,665
Number of Sequences: 355925
Number of extensions: 103665
Number of successful extensions: 27601
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27586
Number of HSP's gapped (non-prelim): 15
length of query: 913
length of database: 217,277,237
effective HSP length: 19
effective length of query: 894
effective length of database: 210,514,662
effective search space: 188200107828
effective search space used: 188200107828
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)