BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3012915.2.2
         (621 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BQ696832.1|BQ696832  NXPV_045_H07_F NXPV (Nsf Xylem Plani...    38   0.41 
gb|BQ696834.1|BQ696834  NXPV_045_H09_F NXPV (Nsf Xylem Plani...    38   0.41 

>gb|BQ696832.1|BQ696832 NXPV_045_H07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus
          taeda cDNA clone NXPV_045_H07 5' similar to Arabidopsis
          thaliana sequence At3g53980 unknown protein see
          http://mips.gsf.de/proj/thal/db/index.html, mRNA
          sequence
          Length = 296

 Score = 38.2 bits (19), Expect = 0.41
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                 
Query: 2  tgcaggaattcggcaccaggctc 24
          |||||||||||||||| ||||||
Sbjct: 42 tgcaggaattcggcacgaggctc 64



>gb|BQ696834.1|BQ696834 NXPV_045_H09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus
          taeda cDNA clone NXPV_045_H09 5' similar to Arabidopsis
          thaliana sequence At5g17440 unknown protein see
          http://mips.gsf.de/proj/thal/db/index.html, mRNA
          sequence
          Length = 420

 Score = 38.2 bits (19), Expect = 0.41
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                 
Query: 2  tgcaggaattcggcaccaggctc 24
          |||||||||||||||| ||||||
Sbjct: 42 tgcaggaattcggcacgaggctc 64



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 71,783
Number of Sequences: 355925
Number of extensions: 71783
Number of successful extensions: 17021
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17019
Number of HSP's gapped (non-prelim): 2
length of query: 621
length of database: 217,277,237
effective HSP length: 19
effective length of query: 602
effective length of database: 210,514,662
effective search space: 126729826524
effective search space used: 126729826524
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)