BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2922023.2.1
(1122 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DR051028.1|DR051028 RTBOR1_27_E11.b1_A029 Roots plus add... 52 5e-005
gb|DR051108.1|DR051108 RTBOR1_27_E11.g1_A029 Roots plus add... 52 5e-005
gb|DR069440.1|DR069440 RTDK1_7_F12.b1_A029 Roots, dark Pinu... 52 5e-005
gb|DR069530.1|DR069530 RTDK1_7_F12.g1_A029 Roots, dark Pinu... 52 5e-005
gb|CX712380.1|CX712380 RTPQ1_2_D10.b2_A032 Roots treated wi... 48 8e-004
gb|CX712459.1|CX712459 RTPQ1_2_D10.g2_A032 Roots treated wi... 48 8e-004
>gb|DR051028.1|DR051028 RTBOR1_27_E11.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_27_E11_A029 3', mRNA sequence
Length = 802
Score = 52.0 bits (26), Expect = 5e-005
Identities = 38/42 (90%)
Strand = Plus / Minus
Query: 847 gagaacgcccagcagctaccgcattggccctggtccttgacg 888
||||| |||||||||||||||||||| || || |||||||||
Sbjct: 179 gagaaggcccagcagctaccgcattgaccttgatccttgacg 138
>gb|DR051108.1|DR051108 RTBOR1_27_E11.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_27_E11_A029 5', mRNA sequence
Length = 856
Score = 52.0 bits (26), Expect = 5e-005
Identities = 38/42 (90%)
Strand = Plus / Minus
Query: 847 gagaacgcccagcagctaccgcattggccctggtccttgacg 888
||||| |||||||||||||||||||| || || |||||||||
Sbjct: 434 gagaaggcccagcagctaccgcattgaccttgatccttgacg 393
>gb|DR069440.1|DR069440 RTDK1_7_F12.b1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_7_F12_A029 3', mRNA sequence
Length = 844
Score = 52.0 bits (26), Expect = 5e-005
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 705 gatgtactggaacgcgtagtccatgaggcccccgttgcagcc 746
|||||||| ||| ||||||||||| ||||| |||||||||||
Sbjct: 253 gatgtactcgaaggcgtagtccatcaggccaccgttgcagcc 294
Score = 42.1 bits (21), Expect = 0.049
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 865 ccgcattggccctggtccttgacgtcggtgacagcgccctt 905
||||| |||||||||||||||||| |||||| || |||||
Sbjct: 416 ccgcactggccctggtccttgacgggggtgacggcaccctt 456
>gb|DR069530.1|DR069530 RTDK1_7_F12.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_7_F12_A029 5', mRNA sequence
Length = 816
Score = 52.0 bits (26), Expect = 5e-005
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 705 gatgtactggaacgcgtagtccatgaggcccccgttgcagcc 746
|||||||| ||| ||||||||||| ||||| |||||||||||
Sbjct: 620 gatgtactcgaaggcgtagtccatcaggccaccgttgcagcc 661
Score = 48.1 bits (24), Expect = 8e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 289 acggggtaggatgcctccatggcgatgccgca 320
||||||||||| ||||||||||| ||||||||
Sbjct: 204 acggggtaggaggcctccatggcaatgccgca 235
Score = 40.1 bits (20), Expect = 0.19
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 865 ccgcattggccctggtccttgacg 888
||||| ||||||||||||||||||
Sbjct: 783 ccgcactggccctggtccttgacg 806
>gb|CX712380.1|CX712380 RTPQ1_2_D10.b2_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_2_D10_A032 3', mRNA sequence
Length = 826
Score = 48.1 bits (24), Expect = 8e-004
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 864 accgcattggccctggtccttgacgtcggtgacagc 899
|||||||||||| |||||||||||| | ||||||||
Sbjct: 169 accgcattggccttggtccttgacggcagtgacagc 134
>gb|CX712459.1|CX712459 RTPQ1_2_D10.g2_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_2_D10_A032 5', mRNA sequence
Length = 679
Score = 48.1 bits (24), Expect = 8e-004
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 864 accgcattggccctggtccttgacgtcggtgacagc 899
|||||||||||| |||||||||||| | ||||||||
Sbjct: 346 accgcattggccttggtccttgacggcagtgacagc 311
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 98,897
Number of Sequences: 355925
Number of extensions: 98897
Number of successful extensions: 29502
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29478
Number of HSP's gapped (non-prelim): 23
length of query: 1122
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1103
effective length of database: 210,514,662
effective search space: 232197672186
effective search space used: 232197672186
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)