BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2921718.2.1
(649 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE452009.1|BE452009 NXCI_007_D01_F NXCI (Nsf Xylem Compr... 52 3e-005
gb|BF609036.1|BF609036 NXSI_039_F08_F NXSI (Nsf Xylem Side ... 52 3e-005
gb|BF778122.1|BF778122 NXSI_077_D07_F NXSI (Nsf Xylem Side ... 52 3e-005
gb|BQ290796.1|BQ290796 NXRV049_F11_F NXRV (Nsf Xylem Root w... 52 3e-005
gb|CO163960.1|CO163960 FLD1_44_H09.g1_A029 Root flooded Pin... 52 3e-005
gb|CO164016.1|CO164016 FLD1_45_F03.b1_A029 Root flooded Pin... 52 3e-005
gb|CO368054.1|CO368054 RTK1_38_H04.b1_A029 Roots minus pota... 52 3e-005
gb|CO368143.1|CO368143 RTK1_38_H04.g1_A029 Roots minus pota... 52 3e-005
gb|CX646834.1|CX646834 COLD1_11_G03.g1_A029 Root cold Pinus... 52 3e-005
gb|DR021258.1|DR021258 STRS1_43_A05.g1_A034 Shoot tip pitch... 52 3e-005
gb|DR078719.1|DR078719 RTFEPL1_6_A06.g1_A029 Roots plus add... 52 3e-005
gb|DR684646.1|DR684646 EST1074723 Normalized pine embryo li... 52 3e-005
gb|DT632226.1|DT632226 EST1147157 Normalized pine embryo li... 52 3e-005
gb|CF664834.1|CF664834 RTCNT1_12_F03.b1_A029 Root control P... 48 4e-004
gb|DR109828.1|DR109828 RTS1_5_F07.b1_A029 Roots minus sulfu... 48 4e-004
gb|CF400003.1|CF400003 RTWW1_2_G01.g1_A015 Well-watered lob... 44 0.007
gb|CO164090.1|CO164090 FLD1_45_F03.g1_A029 Root flooded Pin... 44 0.007
gb|CV035263.1|CV035263 RTNACL1_14_H02.g1_A029 Roots plus ad... 44 0.007
gb|DR059112.1|DR059112 RTNIT1_15_F05.g1_A029 Roots minus ni... 44 0.007
gb|DR110850.1|DR110850 RTS1_13_A01.g1_A029 Roots minus sulf... 44 0.007
gb|DR741980.1|DR741980 RTCU1_1_A06.b1_A029 Roots plus added... 44 0.007
gb|CF478957.1|CF478957 RTWW3_21_C10.b1_A022 Well-watered lo... 42 0.028
gb|CO162271.1|CO162271 FLD1_34_F09.b1_A029 Root flooded Pin... 42 0.028
gb|CO162352.1|CO162352 FLD1_34_F09.g1_A029 Root flooded Pin... 42 0.028
gb|CX651632.1|CX651632 COLD1_53_E12.g1_A029 Root cold Pinus... 42 0.028
gb|DR011092.1|DR011092 HEAT1_3_H07.b1_A029 Root at 37 C for... 42 0.028
gb|DR023804.1|DR023804 STRS1_60_E01.b1_A034 Shoot tip pitch... 42 0.028
gb|DR162276.1|DR162276 RTFE1_16_G03.g1_A029 Roots minus iro... 42 0.028
gb|DR387886.1|DR387886 RTHG1_24_F12.g2_A029 Roots plus adde... 42 0.028
gb|DR388885.1|DR388885 RTHG1_31_C03.b1_A029 Roots plus adde... 42 0.028
gb|DR101537.1|DR101537 STRR1_74_B05.b1_A033 Stem Response R... 40 0.11
gb|DR160314.1|DR160314 RTFE1_5_F12.b1_A029 Roots minus iron... 40 0.11
gb|BF518011.1|BF518011 NXSI_032_H12_F NXSI (Nsf Xylem Side ... 38 0.43
gb|CX648971.1|CX648971 COLD1_32_C10.b1_A029 Root cold Pinus... 38 0.43
gb|DR016335.1|DR016335 STRS1_9_B02.g1_A034 Shoot tip pitch ... 38 0.43
gb|DR050692.1|DR050692 RTBOR1_25_C12.b1_A029 Roots plus add... 38 0.43
gb|DR077984.1|DR077984 RTFEPL1_1_E09.b1_A029 Roots plus add... 38 0.43
gb|DR169070.1|DR169070 RTPHOS1_29_G03.g1_A029 Roots minus p... 38 0.43
gb|DR384746.1|DR384746 RTHG1_4_G05.b1_A029 Roots plus added... 38 0.43
gb|DR745727.1|DR745727 RTCU1_31_H12.g1_A029 Roots plus adde... 38 0.43
>gb|BE452009.1|BE452009 NXCI_007_D01_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_007_D01 5' similar to Arabidopsis
thaliana sequence At2g19680 copia-like retroelement pol
polyprotein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 412
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 5 tgcattgcattgcattgcatcgcatc 30
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 5 tgcattgcattgcattgcatcgcatc 30
>gb|BF609036.1|BF609036 NXSI_039_F08_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_039_F08 5' similar to Arabidopsis thaliana
sequence At2g19680 copia-like retroelement pol
polyprotein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 517
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 17 tgcattgcattgcattgcatcgcatc 42
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 17 tgcattgcattgcattgcatcgcatc 42
>gb|BF778122.1|BF778122 NXSI_077_D07_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_077_D07 5' similar to Arabidopsis thaliana
sequence At2g19680 copia-like retroelement pol
polyprotein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 373
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 32 tgcattgcattgcattgcatcgcatc 57
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 32 tgcattgcattgcattgcatcgcatc 57
>gb|BQ290796.1|BQ290796 NXRV049_F11_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV049_F11 5' similar to Arabidopsis thaliana
sequence At2g19680 copia-like retroelement pol
polyprotein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 483
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 10 tgcattgcattgcattgcatcgcatc 35
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 10 tgcattgcattgcattgcatcgcatc 35
>gb|CO163960.1|CO163960 FLD1_44_H09.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_44_H09_A029 5', mRNA sequence
Length = 839
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 28 tgcattgcattgcattgcatcgcatc 53
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 28 tgcattgcattgcattgcatcgcatc 53
>gb|CO164016.1|CO164016 FLD1_45_F03.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_45_F03_A029 3', mRNA sequence
Length = 835
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 25 tgcattgcattgcattgcatcgcatc 50
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 25 tgcattgcattgcattgcatcgcatc 50
>gb|CO368054.1|CO368054 RTK1_38_H04.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_38_H04_A029 3', mRNA sequence
Length = 822
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 804 tgcattgcattgcattgcatcgcatc 779
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 804 tgcattgcattgcattgcatcgcatc 779
>gb|CO368143.1|CO368143 RTK1_38_H04.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_38_H04_A029 5', mRNA sequence
Length = 790
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 769 tgcattgcattgcattgcatcgcatc 744
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 769 tgcattgcattgcattgcatcgcatc 744
>gb|CX646834.1|CX646834 COLD1_11_G03.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_11_G03_A029 5', mRNA sequence
Length = 796
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 779 tgcattgcattgcattgcatcgcatc 754
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 779 tgcattgcattgcattgcatcgcatc 754
>gb|DR021258.1|DR021258 STRS1_43_A05.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_43_A05_A034 5', mRNA sequence
Length = 688
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 222 tgcattgcattgcattgcatcgcatc 247
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 222 tgcattgcattgcattgcatcgcatc 247
>gb|DR078719.1|DR078719 RTFEPL1_6_A06.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_6_A06_A029 5', mRNA sequence
Length = 633
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 8 tgcattgcattgcattgcatcgcatc 33
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 8 tgcattgcattgcattgcatcgcatc 33
>gb|DR684646.1|DR684646 EST1074723 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAAV08 3' end, mRNA sequence
Length = 689
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 4 tgcattgcattgcattgcatcgcatc 29
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 4 tgcattgcattgcattgcatcgcatc 29
>gb|DT632226.1|DT632226 EST1147157 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMFH78 3' end, mRNA sequence
Length = 853
Score = 52.0 bits (26), Expect = 3e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||||||||
Sbjct: 49 tgcattgcattgcattgcatcgcatc 74
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||| ||||||||||
Sbjct: 49 tgcattgcattgcattgcatcgcatc 74
>gb|CF664834.1|CF664834 RTCNT1_12_F03.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_12_F03_A029 3', mRNA sequence
Length = 637
Score = 48.1 bits (24), Expect = 4e-004
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 335 atcaaatccagcatcctcaagcccgagatcgtcatgtgat 374
|||||||||||||| |||||||| || || ||||||||||
Sbjct: 233 atcaaatccagcattctcaagccagaaattgtcatgtgat 272
>gb|DR109828.1|DR109828 RTS1_5_F07.b1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_5_F07_A029 3', mRNA sequence
Length = 584
Score = 48.1 bits (24), Expect = 4e-004
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 335 atcaaatccagcatcctcaagcccgagatcgtcatgtgat 374
|||||||||||||| |||||||| || || ||||||||||
Sbjct: 80 atcaaatccagcattctcaagccagaaattgtcatgtgat 119
>gb|CF400003.1|CF400003 RTWW1_2_G01.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_2_G01_A015 5', mRNA sequence
Length = 718
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||| ||||||||||||
Sbjct: 12 tgcattgcattgctttgcatcgcatc 37
>gb|CO164090.1|CO164090 FLD1_45_F03.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_45_F03_A029 5', mRNA sequence
Length = 852
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||||| ||||||||
Sbjct: 26 tgcattgcattgcattgtatcgcatc 51
>gb|CV035263.1|CV035263 RTNACL1_14_H02.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_14_H02_A029 5', mRNA sequence
Length = 811
Score = 44.1 bits (22), Expect = 0.007
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 424 ttgcattgcattgcatcgcatc 445
||||||||||||||||||||||
Sbjct: 1 ttgcattgcattgcatcgcatc 22
>gb|DR059112.1|DR059112 RTNIT1_15_F05.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_15_F05_A029 5', mRNA sequence
Length = 716
Score = 44.1 bits (22), Expect = 0.007
Identities = 37/42 (88%)
Strand = Plus / Minus
Query: 332 gagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
||||||||||| | ||| |||||||| ||||| |||||||||
Sbjct: 108 gagatcaaatctaacattctcaagcctgagattgtcatgtga 67
>gb|DR110850.1|DR110850 RTS1_13_A01.g1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_13_A01_A029 5', mRNA sequence
Length = 665
Score = 44.1 bits (22), Expect = 0.007
Identities = 37/42 (88%)
Strand = Plus / Minus
Query: 332 gagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
||||||||||| | ||| |||||||| ||||| |||||||||
Sbjct: 163 gagatcaaatctaacattctcaagcctgagattgtcatgtga 122
>gb|DR741980.1|DR741980 RTCU1_1_A06.b1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_1_A06_A029 3', mRNA sequence
Length = 557
Score = 44.1 bits (22), Expect = 0.007
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 332 gagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
||||||||||| | ||| |||||||| ||||| |||||||||
Sbjct: 364 gagatcaaatctaacattctcaagcctgagattgtcatgtga 405
>gb|CF478957.1|CF478957 RTWW3_21_C10.b1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_21_C10_A022 3', mRNA sequence
Length = 733
Score = 42.1 bits (21), Expect = 0.028
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
||||| ||||||||||||||| |||||| || || |||||||||
Sbjct: 388 aaggaaatcaaatccagcatcaccaagccagaaattgtcatgtga 432
>gb|CO162271.1|CO162271 FLD1_34_F09.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_34_F09_A029 3', mRNA sequence
Length = 705
Score = 42.1 bits (21), Expect = 0.028
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
||||| ||||||||||||||| |||||| || || |||||||||
Sbjct: 395 aaggaaatcaaatccagcatcaccaagccagaaattgtcatgtga 439
>gb|CO162352.1|CO162352 FLD1_34_F09.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_34_F09_A029 5', mRNA sequence
Length = 826
Score = 42.1 bits (21), Expect = 0.028
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
||||| ||||||||||||||| |||||| || || |||||||||
Sbjct: 608 aaggaaatcaaatccagcatcaccaagccagaaattgtcatgtga 652
>gb|CX651632.1|CX651632 COLD1_53_E12.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_53_E12_A029 5', mRNA sequence
Length = 766
Score = 42.1 bits (21), Expect = 0.028
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatc 445
|||||||||||||||||||||
Sbjct: 33 tgcattgcattgcatcgcatc 53
>gb|DR011092.1|DR011092 HEAT1_3_H07.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_3_H07_A029 3', mRNA sequence
Length = 730
Score = 42.1 bits (21), Expect = 0.028
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
||||| ||||||||||||||| |||||| || || |||||||||
Sbjct: 415 aaggaaatcaaatccagcatcaccaagccagaaattgtcatgtga 459
>gb|DR023804.1|DR023804 STRS1_60_E01.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_60_E01_A034 3', mRNA sequence
Length = 830
Score = 42.1 bits (21), Expect = 0.028
Identities = 39/45 (86%)
Strand = Plus / Plus
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
||||| ||||||||||||||| |||||| || || |||||||||
Sbjct: 543 aaggaaatcaaatccagcatcaccaagccagaaattgtcatgtga 587
>gb|DR162276.1|DR162276 RTFE1_16_G03.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_16_G03_A029 5', mRNA sequence
Length = 531
Score = 42.1 bits (21), Expect = 0.028
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatc 445
|||||||||||||||||||||
Sbjct: 3 tgcattgcattgcatcgcatc 23
>gb|DR387886.1|DR387886 RTHG1_24_F12.g2_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_24_F12_A029 5', mRNA sequence
Length = 675
Score = 42.1 bits (21), Expect = 0.028
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatc 445
|||||||||||||||||||||
Sbjct: 1 tgcattgcattgcatcgcatc 21
>gb|DR388885.1|DR388885 RTHG1_31_C03.b1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_31_C03_A029 3', mRNA sequence
Length = 793
Score = 42.1 bits (21), Expect = 0.028
Identities = 39/45 (86%)
Strand = Plus / Minus
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
||||| ||||||||||||||| |||||| || || |||||||||
Sbjct: 128 aaggaaatcaaatccagcatcaccaagccagaaattgtcatgtga 84
>gb|DR101537.1|DR101537 STRR1_74_B05.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_74_B05_A033 3', mRNA sequence
Length = 858
Score = 40.1 bits (20), Expect = 0.11
Identities = 35/40 (87%)
Strand = Plus / Plus
Query: 335 atcaaatccagcatcctcaagcccgagatcgtcatgtgat 374
||||||||||| || |||||||| || || ||||||||||
Sbjct: 458 atcaaatccagtattctcaagccagaaattgtcatgtgat 497
>gb|DR160314.1|DR160314 RTFE1_5_F12.b1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_5_F12_A029 3', mRNA sequence
Length = 734
Score = 40.1 bits (20), Expect = 0.11
Identities = 35/40 (87%)
Strand = Plus / Plus
Query: 335 atcaaatccagcatcctcaagcccgagatcgtcatgtgat 374
||||||||||| || |||||||| || || ||||||||||
Sbjct: 322 atcaaatccagtattctcaagccagaaattgtcatgtgat 361
>gb|BF518011.1|BF518011 NXSI_032_H12_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_032_H12 5' similar to Arabidopsis thaliana
sequence At2g19680 copia-like retroelement pol
polyprotein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 279
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 427 cattgcattgcatcgcatc 445
|||||||||||||||||||
Sbjct: 1 cattgcattgcatcgcatc 19
>gb|CX648971.1|CX648971 COLD1_32_C10.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_32_C10_A029 3', mRNA sequence
Length = 531
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 1 aattcggcacgaggccagg 19
|||||||||||||||||||
Sbjct: 213 aattcggcacgaggccagg 231
>gb|DR016335.1|DR016335 STRS1_9_B02.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_9_B02_A034 5', mRNA sequence
Length = 935
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1 aattcggcacgaggccagg 19
|||||||||||||||||||
Sbjct: 897 aattcggcacgaggccagg 879
>gb|DR050692.1|DR050692 RTBOR1_25_C12.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_25_C12_A029 3', mRNA sequence
Length = 570
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1 aattcggcacgaggccagg 19
|||||||||||||||||||
Sbjct: 569 aattcggcacgaggccagg 551
>gb|DR077984.1|DR077984 RTFEPL1_1_E09.b1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_1_E09_A029 3', mRNA sequence
Length = 774
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1 aattcggcacgaggccagg 19
|||||||||||||||||||
Sbjct: 369 aattcggcacgaggccagg 351
>gb|DR169070.1|DR169070 RTPHOS1_29_G03.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_29_G03_A029 5', mRNA sequence
Length = 375
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgca 438
|||||||||||||||||||
Sbjct: 338 tgcattgcattgcattgca 320
>gb|DR384746.1|DR384746 RTHG1_4_G05.b1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_4_G05_A029 3', mRNA sequence
Length = 450
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1 aattcggcacgaggccagg 19
|||||||||||||||||||
Sbjct: 449 aattcggcacgaggccagg 431
>gb|DR745727.1|DR745727 RTCU1_31_H12.g1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_31_H12_A029 5', mRNA sequence
Length = 650
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 427 cattgcattgcatcgcatc 445
|||||||||||||||||||
Sbjct: 1 cattgcattgcatcgcatc 19
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 66,791
Number of Sequences: 355925
Number of extensions: 66791
Number of successful extensions: 23853
Number of sequences better than 0.5: 41
Number of HSP's better than 0.5 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 23745
Number of HSP's gapped (non-prelim): 94
length of query: 649
length of database: 217,277,237
effective HSP length: 19
effective length of query: 630
effective length of database: 210,514,662
effective search space: 132624237060
effective search space used: 132624237060
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)