BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750929.2.1
(583 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AF286615.1|AF286615 Pinus taeda clone PtTX2082 microsate... 40 0.098
gb|AF277841.1|AF277841 Pinus taeda clone 13g2con microsatel... 40 0.098
gb|AF143959.1|AF143959 Pinus taeda microsatellite PtTX2037 ... 38 0.39
gb|AF286613.1| Pinus taeda clone PtTX2031 microsatellite se... 38 0.39
gb|AF393979.1| Pinus taeda microsatellite PtTX2158 sequence 38 0.39
gb|AF333777.1| Pinus taeda microsatellite PtTX2159 sequence 38 0.39
gb|AF440267.1| Pinus taeda microsatellite PtTX2015 sequence 38 0.39
>gb|AF286615.1|AF286615 Pinus taeda clone PtTX2082 microsatellite sequence
Length = 439
Score = 40.1 bits (20), Expect = 0.098
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 265 tctcactcactcactcactc 246
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 260 ctcactcactcactcactc 242
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 256 ctcactcactcactcactc 238
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 252 ctcactcactcactcactc 234
>gb|AF277841.1|AF277841 Pinus taeda clone 13g2con microsatellite PtTX2082 sequence
Length = 208
Score = 40.1 bits (20), Expect = 0.098
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 73 tctcactcactcactcactc 54
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 68 ctcactcactcactcactc 50
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 64 ctcactcactcactcactc 46
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 60 ctcactcactcactcactc 42
>gb|AF143959.1|AF143959 Pinus taeda microsatellite PtTX2037 sequence
Length = 237
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 92 ctcactcactcactcactc 74
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 88 ctcactcactcactcactc 70
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 84 ctcactcactcactcactc 66
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 80 ctcactcactcactcactc 62
>gb|AF286613.1| Pinus taeda clone PtTX2031 microsatellite sequence
Length = 283
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 184 ctcactcactcactcactc 166
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 180 ctcactcactcactcactc 162
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 176 ctcactcactcactcactc 158
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 172 ctcactcactcactcactc 154
>gb|AF393979.1| Pinus taeda microsatellite PtTX2158 sequence
Length = 517
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 381 ctcactcactcactcactc 399
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 377 ctcactcactcactcactc 395
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 373 ctcactcactcactcactc 391
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 369 ctcactcactcactcactc 387
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 365 ctcactcactcactcactc 383
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 361 ctcactcactcactcactc 379
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 357 ctcactcactcactcactc 375
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 353 ctcactcactcactcactc 371
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 349 ctcactcactcactcactc 367
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 345 ctcactcactcactcactc 363
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 341 ctcactcactcactcactc 359
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 337 ctcactcactcactcactc 355
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 333 ctcactcactcactcactc 351
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 329 ctcactcactcactcactc 347
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 325 ctcactcactcactcactc 343
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 321 ctcactcactcactcactc 339
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 317 ctcactcactcactcactc 335
>gb|AF333777.1| Pinus taeda microsatellite PtTX2159 sequence
Length = 496
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 142 ctcactcactcactcactc 160
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 138 ctcactcactcactcactc 156
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 134 ctcactcactcactcactc 152
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 130 ctcactcactcactcactc 148
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 126 ctcactcactcactcactc 144
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 122 ctcactcactcactcactc 140
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 118 ctcactcactcactcactc 136
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 114 ctcactcactcactcactc 132
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 110 ctcactcactcactcactc 128
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 106 ctcactcactcactcactc 124
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 102 ctcactcactcactcactc 120
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 98 ctcactcactcactcactc 116
>gb|AF440267.1| Pinus taeda microsatellite PtTX2015 sequence
Length = 251
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 131 ctcactcactcactcactc 149
Score = 38.2 bits (19), Expect = 0.39
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactc 93
|||||||||||||||||||
Sbjct: 127 ctcactcactcactcactc 145
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 58,522
Number of Sequences: 355925
Number of extensions: 58522
Number of successful extensions: 14848
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14768
Number of HSP's gapped (non-prelim): 68
length of query: 583
length of database: 217,277,237
effective HSP length: 19
effective length of query: 564
effective length of database: 210,514,662
effective search space: 118730269368
effective search space used: 118730269368
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)