BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750698.2.1
(1126 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DR695015.1|DR695015 EST1085108 Normalized pine embryo li... 50 2e-004
gb|DT638958.1|DT638958 EST1153889 Normalized pine embryo li... 50 2e-004
gb|CF394229.1|CF394229 RTDS2_4_E12.b1_A021 Drought-stressed... 46 0.003
gb|CF394308.1|CF394308 RTDS2_4_E12.g1_A021 Drought-stressed... 46 0.003
gb|CO160206.1|CO160206 FLD1_19_A08.g1_A029 Root flooded Pin... 46 0.003
gb|CX714621.1|CX714621 RTPQ1_24_A11.b1_A032 Roots treated w... 46 0.003
gb|DR097079.1|DR097079 STRR1_32_H04.b1_A033 Stem Response R... 40 0.19
>gb|DR695015.1|DR695015 EST1085108 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAEJ49 3' end, mRNA sequence
Length = 871
Score = 50.1 bits (25), Expect = 2e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 10 gctgctctgcaatctagtgggcagaattgcgctggtgctgaaagattttatgt 62
|||||||| ||||| ||||||||||| || ||||| ||||| || ||||||||
Sbjct: 261 gctgctctacaatcaagtgggcagaactgtgctggcgctgagaggttttatgt 313
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 505 aatgattttgcttcaagttacatgtgccagtctttgccattcggtgg 551
||||| |||||||| || || ||||||||||| |||||||| |||||
Sbjct: 762 aatgactttgcttctagctatatgtgccagtcattgccatttggtgg 808
>gb|DT638958.1|DT638958 EST1153889 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMHL44 3' end, mRNA sequence
Length = 840
Score = 50.1 bits (25), Expect = 2e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 10 gctgctctgcaatctagtgggcagaattgcgctggtgctgaaagattttatgt 62
|||||||| ||||| ||||||||||| || ||||| ||||| || ||||||||
Sbjct: 269 gctgctctacaatcaagtgggcagaactgtgctggcgctgagaggttttatgt 321
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 505 aatgattttgcttcaagttacatgtgccagtctttgccattcggtgg 551
||||| |||||||| || || ||||||||||| |||||||| |||||
Sbjct: 770 aatgactttgcttctagctatatgtgccagtcattgccatttggtgg 816
>gb|CF394229.1|CF394229 RTDS2_4_E12.b1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_4_E12_A021 3', mRNA sequence
Length = 688
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 505 aatgattttgcttcaagttacatgtgccagtctttgccattcggtgg 551
||||| |||||||| || || ||||||||||| |||||||| |||||
Sbjct: 15 aatgactttgcttctagctatatgtgccagtcattgccatttggtgg 61
>gb|CF394308.1|CF394308 RTDS2_4_E12.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_4_E12_A021 5', mRNA sequence
Length = 758
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 505 aatgattttgcttcaagttacatgtgccagtctttgccattcggtgg 551
||||| |||||||| || || ||||||||||| |||||||| |||||
Sbjct: 320 aatgactttgcttctagctatatgtgccagtcattgccatttggtgg 366
>gb|CO160206.1|CO160206 FLD1_19_A08.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_19_A08_A029 5', mRNA sequence
Length = 798
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 505 aatgattttgcttcaagttacatgtgccagtctttgccattcggtgg 551
||||| |||||||| || || ||||||||||| |||||||| |||||
Sbjct: 253 aatgactttgcttctagctatatgtgccagtcattgccatttggtgg 299
>gb|CX714621.1|CX714621 RTPQ1_24_A11.b1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_24_A11_A032 3', mRNA sequence
Length = 861
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 505 aatgattttgcttcaagttacatgtgccagtctttgccattcggtgg 551
||||| |||||||| || || ||||||||||| |||||||| |||||
Sbjct: 196 aatgactttgcttctagctatatgtgccagtcattgccatttggtgg 242
>gb|DR097079.1|DR097079 STRR1_32_H04.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_32_H04_A033 3', mRNA sequence
Length = 853
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 990 ctttagctttcatttcagaa 1009
||||||||||||||||||||
Sbjct: 552 ctttagctttcatttcagaa 571
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 120,073
Number of Sequences: 355925
Number of extensions: 120073
Number of successful extensions: 32009
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31995
Number of HSP's gapped (non-prelim): 14
length of query: 1126
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1107
effective length of database: 210,514,662
effective search space: 233039730834
effective search space used: 233039730834
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)