BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2621786.2.1
(623 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX251594.1|BX251594 BX251594 Pinus pinaster differenciat... 40 0.10
gb|CF389110.1|CF389110 RTDR2_13_F12.g1_A021 Loblolly pine r... 40 0.10
gb|CO161442.1|CO161442 FLD1_28_G04.g1_A029 Root flooded Pin... 40 0.10
gb|CX649085.1|CX649085 COLD1_32_H04.g1_A029 Root cold Pinus... 40 0.10
gb|DR049410.1|DR049410 RTBOR1_16_G01.b1_A029 Roots plus add... 40 0.10
gb|BE187175.1|BE187175 NXNV_160_B08_F Nsf Xylem Normal wood... 38 0.41
gb|CF389075.1|CF389075 RTDR2_13_F12.b1_A021 Loblolly pine r... 38 0.41
gb|CO162328.1|CO162328 FLD1_34_D05.g1_A029 Root flooded Pin... 38 0.41
>gb|BX251594.1|BX251594 BX251594 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP051G03, mRNA sequence
Length = 706
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 317 gccaagaaggagaaggttctggtggatgctgg 348
||||||| |||||||||||| || ||||||||
Sbjct: 548 gccaagagggagaaggttcttgttgatgctgg 579
Score = 38.2 bits (19), Expect = 0.41
Identities = 46/55 (83%)
Strand = Plus / Plus
Query: 12 gggactgggggttcgcgggggactacgtcgaggcaatgtggctcatgctgcagca 66
|||| ||||| || || |||||||| || |||||||||||| | ||| |||||||
Sbjct: 243 gggattggggatttgctggggactatgtggaggcaatgtggttgatgttgcagca 297
>gb|CF389110.1|CF389110 RTDR2_13_F12.g1_A021 Loblolly pine roots recovering from drought
DR2 Pinus taeda cDNA clone RTDR2_13_F12_A021 5', mRNA
sequence
Length = 632
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 317 gccaagaaggagaaggttctggtggatgctgg 348
||||||| |||||||||||| || ||||||||
Sbjct: 323 gccaagagggagaaggttcttgttgatgctgg 292
Score = 38.2 bits (19), Expect = 0.41
Identities = 46/55 (83%)
Strand = Plus / Minus
Query: 12 gggactgggggttcgcgggggactacgtcgaggcaatgtggctcatgctgcagca 66
|||| ||||| || || |||||||| || |||||||||||| | ||| |||||||
Sbjct: 628 gggattggggatttgctggggactatgtggaggcaatgtggttgatgttgcagca 574
>gb|CO161442.1|CO161442 FLD1_28_G04.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_28_G04_A029 5', mRNA sequence
Length = 879
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 317 gccaagaaggagaaggttctggtggatgctgg 348
||||||| |||||||||||| || ||||||||
Sbjct: 388 gccaagagggagaaggttcttgttgatgctgg 357
Score = 38.2 bits (19), Expect = 0.41
Identities = 46/55 (83%)
Strand = Plus / Minus
Query: 12 gggactgggggttcgcgggggactacgtcgaggcaatgtggctcatgctgcagca 66
|||| ||||| || || |||||||| || |||||||||||| | ||| |||||||
Sbjct: 693 gggattggggatttgctggggactatgtggaggcaatgtggttgatgttgcagca 639
>gb|CX649085.1|CX649085 COLD1_32_H04.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_32_H04_A029 5', mRNA sequence
Length = 754
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 317 gccaagaaggagaaggttctggtggatgctgg 348
||||||| |||||||||||| || ||||||||
Sbjct: 622 gccaagagggagaaggttcttgttgatgctgg 653
Score = 38.2 bits (19), Expect = 0.41
Identities = 46/55 (83%)
Strand = Plus / Plus
Query: 12 gggactgggggttcgcgggggactacgtcgaggcaatgtggctcatgctgcagca 66
|||| ||||| || || |||||||| || |||||||||||| | ||| |||||||
Sbjct: 317 gggattggggatttgctggggactatgtggaggcaatgtggttgatgttgcagca 371
>gb|DR049410.1|DR049410 RTBOR1_16_G01.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_16_G01_A029 3', mRNA sequence
Length = 775
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 317 gccaagaaggagaaggttctggtggatgctgg 348
||||||| |||||||||||| || ||||||||
Sbjct: 283 gccaagagggagaaggttcttgttgatgctgg 314
>gb|BE187175.1|BE187175 NXNV_160_B08_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_160_B08 5' similar to Arabidopsis thaliana
sequence At5g66280 GDP-D-mannose 4,6-dehydratase; GMD1
(gb|AAF07199.1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 539
Score = 38.2 bits (19), Expect = 0.41
Identities = 46/55 (83%)
Strand = Plus / Plus
Query: 12 gggactgggggttcgcgggggactacgtcgaggcaatgtggctcatgctgcagca 66
|||| ||||| || || |||||||| || |||||||||||| | ||| |||||||
Sbjct: 256 gggattggggatttgctggggactatgtggaggcaatgtggttgatgttgcagca 310
>gb|CF389075.1|CF389075 RTDR2_13_F12.b1_A021 Loblolly pine roots recovering from drought
DR2 Pinus taeda cDNA clone RTDR2_13_F12_A021 3', mRNA
sequence
Length = 522
Score = 38.2 bits (19), Expect = 0.41
Identities = 46/55 (83%)
Strand = Plus / Minus
Query: 12 gggactgggggttcgcgggggactacgtcgaggcaatgtggctcatgctgcagca 66
|||| ||||| || || |||||||| || |||||||||||| | ||| |||||||
Sbjct: 146 gggattggggatttgctggggactatgtggaggcaatgtggttgatgttgcagca 92
>gb|CO162328.1|CO162328 FLD1_34_D05.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_34_D05_A029 5', mRNA sequence
Length = 780
Score = 38.2 bits (19), Expect = 0.41
Identities = 46/55 (83%)
Strand = Plus / Plus
Query: 12 gggactgggggttcgcgggggactacgtcgaggcaatgtggctcatgctgcagca 66
|||| ||||| || || |||||||| || |||||||||||| | ||| |||||||
Sbjct: 663 gggattggggatttgctggggactatgtggaggcaatgtggttgatgttgcagca 717
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 75,676
Number of Sequences: 355925
Number of extensions: 75676
Number of successful extensions: 20312
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20299
Number of HSP's gapped (non-prelim): 13
length of query: 623
length of database: 217,277,237
effective HSP length: 19
effective length of query: 604
effective length of database: 210,514,662
effective search space: 127150855848
effective search space used: 127150855848
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)