BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2619325.2.1
(1403 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF385091.1|CF385091 RTDR1_1_H08.g1_A015 Loblolly pine ro... 44 0.015
gb|CF386345.1|CF386345 RTDR1_13_H08.g1_A015 Loblolly pine r... 44 0.015
gb|CF387078.1|CF387078 RTDR1_10_H09.g1_A015 Loblolly pine r... 44 0.015
gb|CF387597.1|CF387597 RTDR1_20_H12.g1_A015 Loblolly pine r... 44 0.015
gb|CF387636.1|CF387636 RTDR1_19_C02.b1_A015 Loblolly pine r... 44 0.015
gb|CF391571.1|CF391571 RTDR3_9_C02.g1_A022 Loblolly pine ro... 44 0.015
gb|CF400173.1|CF400173 RTWW1_3_F07.g1_A015 Well-watered lob... 44 0.015
gb|CF401192.1|CF401192 RTWW1_10_H07.g1_A015 Well-watered lo... 44 0.015
gb|CF476953.1|CF476953 RTWW3_4_G10.g1_A022 Well-watered lob... 44 0.015
gb|DR021427.1|DR021427 STRS1_44_C09.g1_A034 Shoot tip pitch... 44 0.015
gb|DR088958.1|DR088958 RTAL1_5_E09.g1_A029 Roots plus added... 44 0.015
gb|DR099898.1|DR099898 STRR1_59_E08.g1_A033 Stem Response R... 44 0.015
gb|DR102256.1|DR102256 STRR1_79_E02.g1_A033 Stem Response R... 44 0.015
gb|DR742871.1|DR742871 RTCU1_7_C01.g2_A029 Roots plus added... 44 0.015
>gb|CF385091.1|CF385091 RTDR1_1_H08.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_1_H08_A015 5', mRNA
sequence
Length = 750
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 186 cttccatgactgcttcgttcagggctgcga 215
>gb|CF386345.1|CF386345 RTDR1_13_H08.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_13_H08_A015 5', mRNA
sequence
Length = 803
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 230 cttccatgactgcttcgttcagggctgcga 259
>gb|CF387078.1|CF387078 RTDR1_10_H09.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_10_H09_A015 5', mRNA
sequence
Length = 718
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 180 cttccatgactgcttcgttcagggctgcga 209
>gb|CF387597.1|CF387597 RTDR1_20_H12.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_20_H12_A015 5', mRNA
sequence
Length = 540
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 205 cttccatgactgcttcgttcagggctgcga 234
>gb|CF387636.1|CF387636 RTDR1_19_C02.b1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_19_C02_A015 3', mRNA
sequence
Length = 592
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 377 cttccatgactgcttcgttcagggctgcga 348
>gb|CF391571.1|CF391571 RTDR3_9_C02.g1_A022 Loblolly pine roots recovering from drought DR3
Pinus taeda cDNA clone RTDR3_9_C02_A022 5', mRNA
sequence
Length = 735
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 235 cttccatgactgcttcgttcagggctgcga 264
>gb|CF400173.1|CF400173 RTWW1_3_F07.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_3_F07_A015 5', mRNA sequence
Length = 765
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 229 cttccatgactgcttcgttcagggctgcga 258
>gb|CF401192.1|CF401192 RTWW1_10_H07.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_10_H07_A015 5', mRNA sequence
Length = 799
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 97 cttccatgactgcttcgttcagggctgcga 126
>gb|CF476953.1|CF476953 RTWW3_4_G10.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_4_G10_A022 5', mRNA sequence
Length = 673
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 208 cttccatgactgcttcgttcagggctgcga 237
>gb|DR021427.1|DR021427 STRS1_44_C09.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_44_C09_A034 5', mRNA sequence
Length = 494
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 214 cttccatgactgcttcgttcagggctgcga 243
>gb|DR088958.1|DR088958 RTAL1_5_E09.g1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_5_E09_A029 5', mRNA sequence
Length = 860
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 183 cttccatgactgcttcgttcagggctgcga 212
>gb|DR099898.1|DR099898 STRR1_59_E08.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_59_E08_A033 5', mRNA sequence
Length = 263
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 187 cttccatgactgcttcgttcagggctgcga 216
>gb|DR102256.1|DR102256 STRR1_79_E02.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_79_E02_A033 5', mRNA sequence
Length = 514
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 200 cttccatgactgcttcgttcagggctgcga 229
>gb|DR742871.1|DR742871 RTCU1_7_C01.g2_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_7_C01_A029 5', mRNA sequence
Length = 717
Score = 44.1 bits (22), Expect = 0.015
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 283 cttccatgactgcttcgtcgagggctgcga 312
|||||||||||||||||| ||||||||||
Sbjct: 219 cttccatgactgcttcgttcagggctgcga 248
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 161,796
Number of Sequences: 355925
Number of extensions: 161796
Number of successful extensions: 50555
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50541
Number of HSP's gapped (non-prelim): 14
length of query: 1403
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1384
effective length of database: 210,514,662
effective search space: 291352292208
effective search space used: 291352292208
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)