BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2591131.2.1
(596 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF386668.1|CF386668 RTDR1_16_C08.b1_A015 Loblolly pine r... 44 0.006
gb|CF386766.1|CF386766 RTDR1_16_C08.g1_A015 Loblolly pine r... 44 0.006
gb|CF400511.1|CF400511 RTWW1_6_B06.b1_A015 Well-watered lob... 44 0.006
gb|CF400637.1|CF400637 RTWW1_6_B06.g1_A015 Well-watered lob... 44 0.006
gb|CF402042.1|CF402042 RTWW1_16_F09.g1_A015 Well-watered lo... 44 0.006
gb|CO197560.1|CO197560 GEO1_7_H02.b1_A029 Root gravitropism... 44 0.006
gb|CF666895.1|CF666895 RTCNT1_26_G11.g1_A029 Root control P... 40 0.10
gb|CO171240.1|CO171240 NDL1_20_C09.b1_A029 Needles control ... 40 0.10
gb|CO171305.1|CO171305 NDL1_20_C09.g1_A029 Needles control ... 40 0.10
gb|DR168662.1|DR168662 RTPHOS1_27_B09.b1_A029 Roots minus p... 40 0.10
gb|CF401946.1|CF401946 RTWW1_16_F09.b1_A015 Well-watered lo... 38 0.40
>gb|CF386668.1|CF386668 RTDR1_16_C08.b1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_16_C08_A015 3', mRNA
sequence
Length = 596
Score = 44.1 bits (22), Expect = 0.006
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccgc 342
||||||||||||| ||||||||||||
Sbjct: 252 actgccagttctgtccccagttccgc 227
>gb|CF386766.1|CF386766 RTDR1_16_C08.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_16_C08_A015 5', mRNA
sequence
Length = 774
Score = 44.1 bits (22), Expect = 0.006
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccgc 342
||||||||||||| ||||||||||||
Sbjct: 670 actgccagttctgtccccagttccgc 645
>gb|CF400511.1|CF400511 RTWW1_6_B06.b1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_6_B06_A015 3', mRNA sequence
Length = 535
Score = 44.1 bits (22), Expect = 0.006
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccgc 342
||||||||||||| ||||||||||||
Sbjct: 189 actgccagttctgtccccagttccgc 164
>gb|CF400637.1|CF400637 RTWW1_6_B06.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_6_B06_A015 5', mRNA sequence
Length = 761
Score = 44.1 bits (22), Expect = 0.006
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccgc 342
||||||||||||| ||||||||||||
Sbjct: 657 actgccagttctgtccccagttccgc 632
>gb|CF402042.1|CF402042 RTWW1_16_F09.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_16_F09_A015 5', mRNA sequence
Length = 753
Score = 44.1 bits (22), Expect = 0.006
Identities = 55/66 (83%)
Strand = Plus / Minus
Query: 319 tgccagttctggccccagttccgccccatcgggatccaccccgtcctcgagcccttcacc 378
||||||||||| ||||||||||| | || || | |||||| || |||| |||||||||
Sbjct: 650 tgccagttctgcccccagttccggctcagaggcagccacccagtattcgaccccttcacc 591
Query: 379 ttcacg 384
||||||
Sbjct: 590 ttcacg 585
>gb|CO197560.1|CO197560 GEO1_7_H02.b1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_7_H02_A029 3', mRNA sequence
Length = 445
Score = 44.1 bits (22), Expect = 0.006
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccgc 342
||||||||||||| ||||||||||||
Sbjct: 99 actgccagttctgtccccagttccgc 74
>gb|CF666895.1|CF666895 RTCNT1_26_G11.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_26_G11_A029 5', mRNA sequence
Length = 779
Score = 40.1 bits (20), Expect = 0.10
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttcc 340
||||||||||||| ||||||||||
Sbjct: 667 actgccagttctgtccccagttcc 644
>gb|CO171240.1|CO171240 NDL1_20_C09.b1_A029 Needles control Pinus taeda cDNA clone
NDL1_20_C09_A029 3', mRNA sequence
Length = 606
Score = 40.1 bits (20), Expect = 0.10
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttcc 340
||||||||||||| ||||||||||
Sbjct: 212 actgccagttctgtccccagttcc 189
>gb|CO171305.1|CO171305 NDL1_20_C09.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_20_C09_A029 5', mRNA sequence
Length = 776
Score = 40.1 bits (20), Expect = 0.10
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttcc 340
||||||||||||| ||||||||||
Sbjct: 664 actgccagttctgtccccagttcc 641
>gb|DR168662.1|DR168662 RTPHOS1_27_B09.b1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_27_B09_A029 3', mRNA sequence
Length = 781
Score = 40.1 bits (20), Expect = 0.10
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttcc 340
||||||||||||| ||||||||||
Sbjct: 417 actgccagttctgtccccagttcc 394
>gb|CF401946.1|CF401946 RTWW1_16_F09.b1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_16_F09_A015 3', mRNA sequence
Length = 542
Score = 38.2 bits (19), Expect = 0.40
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 319 tgccagttctggccccagttccg 341
||||||||||| |||||||||||
Sbjct: 104 tgccagttctgcccccagttccg 82
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 45,622
Number of Sequences: 355925
Number of extensions: 45622
Number of successful extensions: 11013
Number of sequences better than 0.5: 11
Number of HSP's better than 0.5 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10995
Number of HSP's gapped (non-prelim): 17
length of query: 596
length of database: 217,277,237
effective HSP length: 19
effective length of query: 577
effective length of database: 210,514,662
effective search space: 121466959974
effective search space used: 121466959974
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)