BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2576887.2.1
(1138 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AI812905.1|AI812905 22D1 Pine Lambda Zap Xylem library P... 46 0.003
gb|BX253470.1|BX253470 BX253470 Pinus pinaster differenciat... 46 0.003
gb|BF186438.1|BF186438 NXCI_137_D08_F NXCI (Nsf Xylem Compr... 46 0.003
gb|BF777199.1|BF777199 NXSI_066_D07_F NXSI (Nsf Xylem Side ... 46 0.003
gb|BF777643.1|BF777643 NXSI_070_H06_F NXSI (Nsf Xylem Side ... 46 0.003
gb|BQ699755.1|BQ699755 NXRV128_E06_F NXRV (Nsf Xylem Root w... 46 0.003
gb|BQ701198.1|BQ701198 NXSI_023_F11_F NXSI (Nsf Xylem Side ... 46 0.003
dbj|BD262154.1| Composition and methods for the modificatio... 44 0.012
dbj|DD014292.1| Compositions and Methods for the Modificati... 44 0.012
gb|AW289659.1|AW289659 NXNV003D07F Nsf Xylem Normal wood Ve... 40 0.19
gb|CD028201.1|CD028201 NXNV003D07 Nsf Xylem Normal wood Ver... 40 0.19
>gb|AI812905.1|AI812905 22D1 Pine Lambda Zap Xylem library Pinus taeda cDNA, mRNA sequence
Length = 594
Score = 46.1 bits (23), Expect = 0.003
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 436 ttctgggctcacgagtgggagaaacatggaacctgctct 474
||||||| |||||||||||||||||||| || ||||||
Sbjct: 371 ttctggggacacgagtgggagaaacatggcacttgctct 409
>gb|BX253470.1|BX253470 BX253470 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP083H05, mRNA sequence
Length = 677
Score = 46.1 bits (23), Expect = 0.003
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 436 ttctgggctcacgagtgggagaaacatggaacctgctct 474
||||||| |||||||||||||||||||| || ||||||
Sbjct: 441 ttctggggacacgagtgggagaaacatggcacttgctct 479
>gb|BF186438.1|BF186438 NXCI_137_D08_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_137_D08 5' similar to Arabidopsis
thaliana sequence At1g26820 ribonuclease RNS3 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 399
Score = 46.1 bits (23), Expect = 0.003
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 436 ttctgggctcacgagtgggagaaacatggaacctgctct 474
||||||| |||||||||||||||||||| || ||||||
Sbjct: 164 ttctggggacacgagtgggagaaacatggcacttgctct 202
>gb|BF777199.1|BF777199 NXSI_066_D07_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_066_D07 5' similar to Arabidopsis thaliana
sequence At1g26820 ribonuclease RNS3 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 506
Score = 46.1 bits (23), Expect = 0.003
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 436 ttctgggctcacgagtgggagaaacatggaacctgctct 474
||||||| |||||||||||||||||||| || ||||||
Sbjct: 370 ttctggggacacgagtgggagaaacatggcacttgctct 408
>gb|BF777643.1|BF777643 NXSI_070_H06_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_070_H06 5' similar to Arabidopsis thaliana
sequence At2g02990 putative ribonuclease, RNS1 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 337
Score = 46.1 bits (23), Expect = 0.003
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 436 ttctgggctcacgagtgggagaaacatggaacctgctct 474
||||||| |||||||||||||||||||| || ||||||
Sbjct: 114 ttctggggacacgagtgggagaaacatggcacttgctct 152
>gb|BQ699755.1|BQ699755 NXRV128_E06_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV128_E06 5' similar to Arabidopsis thaliana
sequence At1g26820 ribonuclease RNS3 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 500
Score = 46.1 bits (23), Expect = 0.003
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 436 ttctgggctcacgagtgggagaaacatggaacctgctct 474
||||||| |||||||||||||||||||| || ||||||
Sbjct: 383 ttctggggacacgagtgggagaaacatggcacttgctct 421
>gb|BQ701198.1|BQ701198 NXSI_023_F11_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_023_F11 5' similar to Arabidopsis thaliana
sequence At2g02990 putative ribonuclease, RNS1 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 475
Score = 46.1 bits (23), Expect = 0.003
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 436 ttctgggctcacgagtgggagaaacatggaacctgctct 474
||||||| |||||||||||||||||||| || ||||||
Sbjct: 3 ttctggggacacgagtgggagaaacatggcacttgctct 41
>dbj|BD262154.1| Composition and methods for the modification of gene expression
Length = 1038
Score = 44.1 bits (22), Expect = 0.012
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 445 cacgagtgggagaaacatggaacctgctct 474
|||||||||||||||||||| || ||||||
Sbjct: 557 cacgagtgggagaaacatggcacttgctct 586
>dbj|DD014292.1| Compositions and Methods for the Modification of Gene Expression
Length = 1038
Score = 44.1 bits (22), Expect = 0.012
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 445 cacgagtgggagaaacatggaacctgctct 474
|||||||||||||||||||| || ||||||
Sbjct: 557 cacgagtgggagaaacatggcacttgctct 586
>gb|AW289659.1|AW289659 NXNV003D07F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV003D07 5', mRNA sequence
Length = 412
Score = 40.1 bits (20), Expect = 0.19
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 436 ttctgggctcacgagtgggagaaacatg 463
||||||| |||||||||||||||||||
Sbjct: 191 ttctggggacacgagtgggagaaacatg 218
>gb|CD028201.1|CD028201 NXNV003D07 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV003D07 5' similar to Arabidopsis thaliana sequence
At2g02990 putative ribonuclease, RNS1 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 412
Score = 40.1 bits (20), Expect = 0.19
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 436 ttctgggctcacgagtgggagaaacatg 463
||||||| |||||||||||||||||||
Sbjct: 191 ttctggggacacgagtgggagaaacatg 218
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 121,360
Number of Sequences: 355925
Number of extensions: 121360
Number of successful extensions: 33746
Number of sequences better than 0.5: 11
Number of HSP's better than 0.5 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33735
Number of HSP's gapped (non-prelim): 11
length of query: 1138
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1119
effective length of database: 210,514,662
effective search space: 235565906778
effective search space used: 235565906778
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)