BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2521589.2.1
(1689 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF669075.1|CF669075 RTCNT1_40_B01.g1_A029 Root control P... 202 3e-050
gb|CF672446.1|CF672446 RTCNT1_63_D08.g1_A029 Root control P... 202 3e-050
gb|CO198374.1|CO198374 GEO1_13_E11.b1_A029 Root gravitropis... 202 3e-050
gb|CO367203.1|CO367203 RTK1_32_G09.g1_A029 Roots minus pota... 202 3e-050
gb|CV137929.1|CV137929 EST849138 Sequencing ESTs from loblo... 202 3e-050
gb|DN459740.1|DN459740 EST955539 Sequencing ESTs from loblo... 202 3e-050
gb|CF479694.1|CF479694 RTWW3_11_A12.g1_A022 Well-watered lo... 194 8e-048
gb|CO366112.1|CO366112 RTK1_25_H12.g1_A029 Roots minus pota... 194 8e-048
gb|CV137016.1|CV137016 EST848225 Sequencing ESTs from loblo... 194 8e-048
gb|CV145292.1|CV145292 EST856501 Sequencing ESTs from loblo... 194 8e-048
gb|CV148003.1|CV148003 EST859212 Sequencing ESTs from loblo... 194 8e-048
gb|DN458423.1|DN458423 EST954222 Sequencing ESTs from loblo... 194 8e-048
gb|DN459149.1|DN459149 EST954948 Sequencing ESTs from loblo... 194 8e-048
gb|DN460431.1|DN460431 EST956230 Sequencing ESTs from loblo... 194 8e-048
gb|DR048562.1|DR048562 RTBOR1_9_E10.g1_A029 Roots plus adde... 194 8e-048
gb|DR051105.1|DR051105 RTBOR1_27_E08.g1_A029 Roots plus add... 194 8e-048
gb|DR081268.1|DR081268 RTFEPL1_28_B04.g1_A029 Roots plus ad... 194 8e-048
gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (T... 194 8e-048
emb|BX784398.1| Pinus pinaster STS PPC4HP1, sequence tagged... 194 8e-048
gb|BX681070.1|BX681070 BX681070 RS Pinus pinaster cDNA clon... 192 3e-047
gb|CF386137.1|CF386137 RTDR1_8_D09.g1_A015 Loblolly pine ro... 190 1e-046
gb|CF386488.1|CF386488 RTDR1_14_G02.g1_A015 Loblolly pine r... 190 1e-046
gb|CV137537.1|CV137537 EST848746 Sequencing ESTs from loblo... 188 5e-046
gb|CX648893.1|CX648893 COLD1_31_D03.g1_A029 Root cold Pinus... 188 5e-046
gb|DR091337.1|DR091337 RTAL1_20_H12.g1_A029 Roots plus adde... 170 1e-040
gb|CO159587.1|CO159587 FLD1_14_B09.g1_A029 Root flooded Pin... 159 5e-037
gb|BG276034.1|BG276034 NXSI_147_H11_F NXSI (Nsf Xylem Side ... 151 1e-034
gb|BG319095.1|BG319095 NXPV_023_F10_F NXPV (Nsf Xylem Plani... 151 1e-034
gb|AI812674.1|AI812674 17G2 Pine Lambda Zap Xylem library P... 145 7e-033
gb|CF667497.1|CF667497 RTCNT1_30_D11.g1_A029 Root control P... 143 3e-032
gb|DN456247.1|DN456247 EST952046 Sequencing ESTs from loblo... 143 3e-032
gb|BX254757.1|BX254757 BX254757 Pinus pinaster differenciat... 139 4e-031
gb|BX254922.1|BX254922 BX254922 Pinus pinaster differenciat... 139 4e-031
gb|BE761856.1|BE761856 NXCI_070_F06_F NXCI (Nsf Xylem Compr... 133 3e-029
gb|BE762259.1|BE762259 NXCI_067_C10_F NXCI (Nsf Xylem Compr... 133 3e-029
gb|BE762275.1|BE762275 NXCI_067_E07_F NXCI (Nsf Xylem Compr... 133 3e-029
gb|BF186455.1|BF186455 NXCI_137_F12_F NXCI (Nsf Xylem Compr... 133 3e-029
gb|BF517288.1|BF517288 NXSI_012_F04_F NXSI (Nsf Xylem Side ... 133 3e-029
gb|CF385486.1|CF385486 RTDR1_4_A06.b1_A015 Loblolly pine ro... 133 3e-029
gb|CF670152.1|CF670152 RTCNT1_48_A01.g1_A029 Root control P... 133 3e-029
gb|CO367943.1|CO367943 RTK1_37_D12.g1_A029 Roots minus pota... 133 3e-029
gb|CV035647.1|CV035647 RTNACL1_41_B03.g1_A029 Roots plus ad... 133 3e-029
gb|CV035656.1|CV035656 RTNACL1_41_C03.g1_A029 Roots plus ad... 133 3e-029
gb|CX648414.1|CX648414 COLD1_28_B08.g1_A029 Root cold Pinus... 133 3e-029
gb|DR069698.1|DR069698 RTDK1_8_H09.g1_A029 Roots, dark Pinu... 133 3e-029
gb|DR069823.1|DR069823 RTDK1_9_D10.g1_A029 Roots, dark Pinu... 133 3e-029
gb|DR081652.1|DR081652 RTFEPL1_31_E09.b1_A029 Roots plus ad... 133 3e-029
gb|DR099065.1|DR099065 STRR1_52_H11.b1_A033 Stem Response R... 133 3e-029
gb|DR385406.1|DR385406 RTHG1_8_A11.g1_A029 Roots plus added... 133 3e-029
gb|AH014354.1|SEG_AY764801S Pinus taeda isolate 16 cinnamat... 133 3e-029
gb|AY764801.1|AY764801S1 Pinus taeda isolate 16 cinnamate 4... 133 3e-029
gb|AH014355.1|SEG_AY764805S Pinus taeda isolate 6 cinnamate... 133 3e-029
gb|AY764805.1|AY764805S1 Pinus taeda isolate 6 cinnamate 4-... 133 3e-029
gb|AH014356.1|SEG_AY764809S Pinus taeda isolate 4 cinnamate... 133 3e-029
gb|AY764809.1|AY764809S1 Pinus taeda isolate 4 cinnamate 4-... 133 3e-029
gb|AH014357.1|SEG_AY764813S Pinus taeda isolate 26 cinnamat... 133 3e-029
gb|AY764813.1|AY764813S1 Pinus taeda isolate 26 cinnamate 4... 133 3e-029
gb|AH014358.1|SEG_AY764817S Pinus taeda isolate 9 cinnamate... 133 3e-029
gb|AY764817.1|AY764817S1 Pinus taeda isolate 9 cinnamate 4-... 133 3e-029
gb|AH014359.1|SEG_AY764821S Pinus taeda isolate 23 cinnamat... 133 3e-029
gb|AY764821.1|AY764821S1 Pinus taeda isolate 23 cinnamate 4... 133 3e-029
gb|AH014360.1|SEG_AY764825S Pinus taeda isolate 22 cinnamat... 133 3e-029
gb|AY764825.1|AY764825S1 Pinus taeda isolate 22 cinnamate 4... 133 3e-029
gb|AH014361.1|SEG_AY764829S Pinus taeda isolate 32 cinnamat... 133 3e-029
gb|AY764829.1|AY764829S1 Pinus taeda isolate 32 exon 1 ; an... 133 3e-029
gb|AH014362.1|SEG_AY764833S Pinus taeda isolate 18 cinnamat... 133 3e-029
gb|AY764833.1|AY764833S1 Pinus taeda isolate 18 exon 1 ; an... 133 3e-029
gb|AH014363.1|SEG_AY764837S Pinus taeda isolate 21 cinnamat... 133 3e-029
gb|AY764837.1|AY764837S1 Pinus taeda isolate 21 exon 1 ; an... 133 3e-029
gb|AH014364.1|SEG_AY764841S Pinus taeda isolate 31 cinnamat... 133 3e-029
gb|AY764841.1|AY764841S1 Pinus taeda isolate 31 cinnamate 4... 133 3e-029
gb|AH014365.1|SEG_AY764845S Pinus taeda isolate 5 cinnamate... 133 3e-029
gb|AY764845.1|AY764845S1 Pinus taeda isolate 5 exon 1 ; and... 133 3e-029
gb|AH014366.1|SEG_AY764849S Pinus taeda isolate 15 cinnamat... 133 3e-029
gb|AY764849.1|AY764849S1 Pinus taeda isolate 15 cinnamate 4... 133 3e-029
gb|AH014367.1|SEG_AY764853S Pinus taeda isolate 20 cinnamat... 133 3e-029
gb|AY764853.1|AY764853S1 Pinus taeda isolate 20 cinnamate 4... 133 3e-029
gb|AH014368.1|SEG_AY764857S Pinus taeda isolate 12 cinnamat... 133 3e-029
gb|AY764857.1|AY764857S1 Pinus taeda isolate 12 cinnamate 4... 133 3e-029
gb|AH014369.1|SEG_AY764861S Pinus taeda isolate 24 cinnamat... 133 3e-029
gb|AY764861.1|AY764861S1 Pinus taeda isolate 24 cinnamate 4... 133 3e-029
gb|AH014370.1|SEG_AY764865S Pinus taeda isolate 11 cinnamat... 133 3e-029
gb|AY764865.1|AY764865S1 Pinus taeda isolate 11 cinnamate 4... 133 3e-029
gb|AH014371.1|SEG_AY764869S Pinus taeda isolate 7 cinnamate... 133 3e-029
gb|AY764869.1|AY764869S1 Pinus taeda isolate 7 cinnamate 4-... 133 3e-029
gb|AH014372.1|SEG_AY764873S Pinus taeda isolate 25 cinnamat... 133 3e-029
gb|AY764873.1|AY764873S1 Pinus taeda isolate 25 cinnamate 4... 133 3e-029
gb|AH014373.1|SEG_AY764877S Pinus taeda isolate 13 cinnamat... 133 3e-029
gb|AY764877.1|AY764877S1 Pinus taeda isolate 13 cinnamate 4... 133 3e-029
gb|AH014374.1|SEG_AY764881S Pinus taeda isolate 30 cinnamat... 133 3e-029
gb|AY764881.1|AY764881S1 Pinus taeda isolate 30 cinnamate 4... 133 3e-029
gb|AH014375.1|SEG_AY764885S Pinus taeda isolate 14 cinnamat... 133 3e-029
gb|AY764885.1|AY764885S1 Pinus taeda isolate 14 cinnamate 4... 133 3e-029
gb|AH014376.1|SEG_AY764889S Pinus taeda isolate 10 cinnamat... 133 3e-029
gb|AY764889.1|AY764889S1 Pinus taeda isolate 10 cinnamate 4... 133 3e-029
gb|AH014377.1|SEG_AY764893S Pinus taeda isolate 2 cinnamate... 133 3e-029
gb|AY764893.1|AY764893S1 Pinus taeda isolate 2 cinnamate 4-... 133 3e-029
gb|AH014378.1|SEG_AY764897S Pinus taeda isolate 3 cinnamate... 133 3e-029
gb|AY764897.1|AY764897S1 Pinus taeda isolate 3 cinnamate 4-... 133 3e-029
gb|AH014379.1|SEG_AY764901S Pinus taeda isolate 19 cinnamat... 133 3e-029
gb|AY764901.1|AY764901S1 Pinus taeda isolate 19 cinnamate 4... 133 3e-029
gb|AH014380.1|SEG_AY764905S Pinus taeda isolate 28 cinnamat... 133 3e-029
gb|AY764905.1|AY764905S1 Pinus taeda isolate 28 cinnamate 4... 133 3e-029
gb|AH014381.1|SEG_AY764909S Pinus taeda isolate 8 cinnamate... 133 3e-029
gb|AY764909.1|AY764909S1 Pinus taeda isolate 8 cinnamate 4-... 133 3e-029
gb|AH014382.1|SEG_AY764913S Pinus taeda isolate 17 cinnamat... 133 3e-029
gb|AY764913.1|AY764913S1 Pinus taeda isolate 17 cinnamate 4... 133 3e-029
gb|AH014383.1|SEG_AY764917S Pinus taeda isolate 1 cinnamate... 133 3e-029
gb|AY764917.1|AY764917S1 Pinus taeda isolate 1 cinnamate 4-... 133 3e-029
gb|AH014384.1|SEG_AY764921S Pinus taeda isolate 29 cinnamat... 133 3e-029
gb|AY764921.1|AY764921S1 Pinus taeda isolate 29 cinnamate 4... 133 3e-029
gb|AH014385.1|SEG_AY764925S Pinus taeda isolate 27 cinnamat... 133 3e-029
gb|AY764925.1|AY764925S1 Pinus taeda isolate 27 cinnamate 4... 133 3e-029
gb|BQ290684.1|BQ290684 NXRV048_D03_F NXRV (Nsf Xylem Root w... 129 4e-028
gb|BQ702116.1|BQ702116 NXSI_125_B04_F NXSI (Nsf Xylem Side ... 129 4e-028
gb|BE458069.1|BE458069 NXCI_005_E12_F NXCI (Nsf Xylem Compr... 125 6e-027
dbj|BD224278.1| Materials and methods for the modification ... 125 6e-027
dbj|BD224324.1| Materials and methods for the modification ... 125 6e-027
dbj|BD224368.1| Materials and methods for the modification ... 125 6e-027
dbj|BD224400.1| Materials and methods for the modification ... 125 6e-027
dbj|BD272995.1| Materials and methods for the modification ... 125 6e-027
gb|BF609785.1|BF609785 NXSI_050_D04_F NXSI (Nsf Xylem Side ... 115 6e-024
gb|BQ699081.1|BQ699081 NXRV119_C01_F NXRV (Nsf Xylem Root w... 115 6e-024
gb|DR178124.1|DR178124 RTMNUT1_9_B04.g1_A029 Roots minus mi... 109 4e-022
gb|DR016895.1|DR016895 STRS1_12_G05.g1_A034 Shoot tip pitch... 107 1e-021
gb|AW758584.1|AW758584 NXNV_075_B10_F Nsf Xylem Normal wood... 101 9e-020
gb|CD020765.1|CD020765 NXNV_075_B08_F Nsf Xylem Normal wood... 101 9e-020
gb|CF385356.1|CF385356 RTDR1_3_A03.g1_A015 Loblolly pine ro... 90 3e-016
gb|CF388060.1|CF388060 RTDR1_17_B12.g1_A015 Loblolly pine r... 90 3e-016
gb|CF474252.1|CF474252 RTWW2_17_C11.g1_A021 Well-watered lo... 90 3e-016
gb|DR053536.1|DR053536 RTCA1_11_F10.g1_A029 Roots minus cal... 90 3e-016
gb|DR079331.1|DR079331 RTFEPL1_10_C11.g1_A029 Roots plus ad... 90 3e-016
gb|DR166133.1|DR166133 RTPHOS1_9_E01.g2_A029 Roots minus ph... 90 3e-016
gb|BF186023.1|BF186023 NXCI_132_C02_F NXCI (Nsf Xylem Compr... 84 2e-014
gb|BX676842.1|BX676842 BX676842 RN Pinus pinaster cDNA clon... 84 2e-014
gb|AA556941.1|AA556941 783 Loblolly pine C Pinus taeda cDNA... 82 9e-014
gb|BX251949.1|BX251949 BX251949 Pinus pinaster differenciat... 82 9e-014
gb|BX252744.1|BX252744 BX252744 Pinus pinaster differenciat... 82 9e-014
gb|BX252751.1|BX252751 BX252751 Pinus pinaster differenciat... 82 9e-014
gb|BE643861.1|BE643861 NXCI_048_C02_F NXCI (Nsf Xylem Compr... 82 9e-014
gb|BE762045.1|BE762045 NXCI_076_D03_F NXCI (Nsf Xylem Compr... 82 9e-014
gb|BE762243.1|BE762243 NXCI_083_H11_F NXCI (Nsf Xylem Compr... 82 9e-014
gb|BE997017.1|BE997017 NXCI_097_F09_F NXCI (Nsf Xylem Compr... 82 9e-014
gb|BF049831.1|BF049831 NXCI_111_E01_F NXCI (Nsf Xylem Compr... 82 9e-014
gb|BF609655.1|BF609655 NXSI_047_G02_F NXSI (Nsf Xylem Side ... 82 9e-014
gb|BF610527.1|BF610527 NXSI_059_F06_F NXSI (Nsf Xylem Side ... 82 9e-014
gb|BG275633.1|BG275633 NXSI_144_B02_F NXSI (Nsf Xylem Side ... 82 9e-014
gb|CF385565.1|CF385565 RTDR1_4_A02.g1_A015 Loblolly pine ro... 82 9e-014
gb|CF387281.1|CF387281 RTDR1_11_A09.g1_A015 Loblolly pine r... 82 9e-014
gb|CF387741.1|CF387741 RTDR1_19_A10.g1_A015 Loblolly pine r... 82 9e-014
gb|CF389425.1|CF389425 RTDR2_7_E10.g1_A021 Loblolly pine ro... 82 9e-014
gb|CF395618.1|CF395618 RTDS2_12_H02.g1_A021 Drought-stresse... 82 9e-014
gb|CF398102.1|CF398102 RTDS3_21_C08.b1_A022 Drought-stresse... 82 9e-014
gb|CF398799.1|CF398799 RTDS3_16_E11.b1_A022 Drought-stresse... 82 9e-014
gb|CF399422.1|CF399422 RTDS3_28_D06.g1_A022 Drought-stresse... 82 9e-014
gb|CF399839.1|CF399839 RTWW1_1_H11.g1_A015 Well-watered lob... 82 9e-014
gb|CF400053.1|CF400053 RTWW1_2_B07.g1_A015 Well-watered lob... 82 9e-014
gb|CF400856.1|CF400856 RTWW1_8_G10.g1_A015 Well-watered lob... 82 9e-014
gb|CF401178.1|CF401178 RTWW1_10_F06.g1_A015 Well-watered lo... 82 9e-014
gb|CF402046.1|CF402046 RTWW1_16_D12.g1_A015 Well-watered lo... 82 9e-014
gb|CF402326.1|CF402326 RTWW1_19_E10.g1_A015 Well-watered lo... 82 9e-014
gb|CF402889.1|CF402889 RTWW1_23_D03.g1_A015 Well-watered lo... 82 9e-014
gb|CF402941.1|CF402941 RTWW1_23_C03.g1_A015 Well-watered lo... 82 9e-014
gb|CF471315.1|CF471315 RTDS1_2_D09.g1_A015 Drought-stressed... 82 9e-014
gb|CF471924.1|CF471924 RTDS1_7_G12.g1_A015 Drought-stressed... 82 9e-014
gb|CF474751.1|CF474751 RTWW2_7_D12.g1_A021 Well-watered lob... 82 9e-014
gb|CF476104.1|CF476104 RTWW2_21_H07.b1_A021 Well-watered lo... 82 9e-014
gb|CF476197.1|CF476197 RTWW2_21_B01.g1_A021 Well-watered lo... 82 9e-014
gb|CF477426.1|CF477426 RTWW3_7_H02.g1_A022 Well-watered lob... 82 9e-014
gb|CF664502.1|CF664502 RTCNT1_10_E07.b1_A029 Root control P... 82 9e-014
gb|CF665390.1|CF665390 RTCNT1_15_F02.g1_A029 Root control P... 82 9e-014
gb|CF669355.1|CF669355 RTCNT1_42_F10.g1_A029 Root control P... 82 9e-014
gb|CF670004.1|CF670004 RTCNT1_47_B04.g1_A029 Root control P... 82 9e-014
gb|CO158422.1|CO158422 FLD1_6_G03.g1_A029 Root flooded Pinu... 82 9e-014
gb|CO161408.1|CO161408 FLD1_28_D03.g1_A029 Root flooded Pin... 82 9e-014
gb|CO198126.1|CO198126 GEO1_11_A08.g1_A029 Root gravitropis... 82 9e-014
gb|CO199955.1|CO199955 GEO2_4_C04.g1_A032 Root gravitropism... 82 9e-014
gb|CO368135.1|CO368135 RTK1_38_G08.g1_A029 Roots minus pota... 82 9e-014
gb|CX645269.1|CX645269 COLD1_1_C08.g1_A029 Root cold Pinus ... 82 9e-014
gb|CX714349.1|CX714349 RTPQ1_20_G01.g1_A032 Roots treated w... 82 9e-014
gb|DN454332.1|DN454332 EST950131 Sequencing ESTs from loblo... 82 9e-014
gb|DR010779.1|DR010779 HEAT1_1_F06.b1_A029 Root at 37 C for... 82 9e-014
gb|DR010857.1|DR010857 HEAT1_1_F06.g1_A029 Root at 37 C for... 82 9e-014
gb|DR022465.1|DR022465 STRS1_51_F01.b1_A034 Shoot tip pitch... 82 9e-014
gb|DR022529.1|DR022529 STRS1_51_F01.g1_A034 Shoot tip pitch... 82 9e-014
gb|DR069623.1|DR069623 RTDK1_8_H09.b1_A029 Roots, dark Pinu... 82 9e-014
gb|DR077974.1|DR077974 RTFEPL1_1_D06.b1_A029 Roots plus add... 82 9e-014
gb|DR078053.1|DR078053 RTFEPL1_1_D06.g1_A029 Roots plus add... 82 9e-014
gb|DR078079.1|DR078079 RTFEPL1_1_G01.g1_A029 Roots plus add... 82 9e-014
gb|DR097597.1|DR097597 STRR1_35_F09.g4_A033 Stem Response R... 82 9e-014
gb|DR098151.1|DR098151 STRR1_39_A09.g1_A033 Stem Response R... 82 9e-014
gb|DR098259.1|DR098259 STRR1_40_E06.b1_A033 Stem Response R... 82 9e-014
gb|DR098329.1|DR098329 STRR1_40_E06.g1_A033 Stem Response R... 82 9e-014
gb|DR099653.1|DR099653 STRR1_57_D07.b1_A033 Stem Response R... 82 9e-014
gb|DR099765.1|DR099765 STRR1_58_G09.b1_A033 Stem Response R... 82 9e-014
gb|DR101658.1|DR101658 STRR1_74_H05.g1_A033 Stem Response R... 82 9e-014
gb|DR180889.1|DR180889 RTMNUT1_35_B03.g1_A029 Roots minus m... 82 9e-014
gb|DR385097.1|DR385097 RTHG1_6_D02.g1_A029 Roots plus added... 82 9e-014
gb|DR388516.1|DR388516 RTHG1_28_F03.g1_A029 Roots plus adde... 82 9e-014
gb|DR388680.1|DR388680 RTHG1_29_G06.g1_A029 Roots plus adde... 82 9e-014
gb|DR742942.1|DR742942 RTCU1_8_B04.g2_A029 Roots plus added... 82 9e-014
gb|DR743628.1|DR743628 RTCU1_17_D07.b1_A029 Roots plus adde... 82 9e-014
gb|DR743699.1|DR743699 RTCU1_17_D07.g1_A029 Roots plus adde... 82 9e-014
gb|DR743784.1|DR743784 RTCU1_18_D07.b1_A029 Roots plus adde... 82 9e-014
dbj|BD224279.1| Materials and methods for the modification ... 82 9e-014
gb|BF609865.1|BF609865 NXSI_051_H12_F NXSI (Nsf Xylem Side ... 80 3e-013
gb|BQ702923.1|BQ702923 NXSI_134_C08_F NXSI (Nsf Xylem Side ... 80 3e-013
gb|DR053547.1|DR053547 RTCA1_11_G10.g1_A029 Roots minus cal... 78 1e-012
gb|AI812771.1|AI812771 18H4 Pine Lambda Zap Xylem library P... 76 5e-012
gb|AI812842.1|AI812842 20F6 Pine Lambda Zap Xylem library P... 76 5e-012
gb|AW042602.1|AW042602 ST23G12 Pine TriplEx shoot tip libra... 76 5e-012
gb|BX254863.1|BX254863 BX254863 Pinus pinaster differenciat... 76 5e-012
gb|BX254943.1|BX254943 BX254943 Pinus pinaster differenciat... 76 5e-012
gb|AW888069.1|AW888069 NXNV_126_H07_F Nsf Xylem Normal wood... 76 5e-012
gb|BE187217.1|BE187217 NXNV_160_G02_F Nsf Xylem Normal wood... 76 5e-012
gb|BE187218.1|BE187218 NXNV_160_G03_F Nsf Xylem Normal wood... 76 5e-012
gb|BE187484.1|BE187484 NXNV_98_G10_F Nsf Xylem Normal wood ... 76 5e-012
gb|BE643912.1|BE643912 NXCI_048_H09_F NXCI (Nsf Xylem Compr... 76 5e-012
gb|BE996954.1|BE996954 NXCI_093_B07_F NXCI (Nsf Xylem Compr... 76 5e-012
gb|BF221256.1|BF221256 NXCI_156_F01_F NXCI (Nsf Xylem Compr... 76 5e-012
gb|BF777569.1|BF777569 NXSI_070_A12_F NXSI (Nsf Xylem Side ... 76 5e-012
gb|BF778666.1|BF778666 NXSI_090_D08_F NXSI (Nsf Xylem Side ... 76 5e-012
gb|BG039758.1|BG039758 NXSI_103_F12_F NXSI (Nsf Xylem Side ... 76 5e-012
gb|BG040113.1|BG040113 NXSI_106_F02_F NXSI (Nsf Xylem Side ... 76 5e-012
gb|BG275516.1|BG275516 NXSI_139_E05_F NXSI (Nsf Xylem Side ... 76 5e-012
gb|BG276019.1|BG276019 NXSI_147_E12_F NXSI (Nsf Xylem Side ... 76 5e-012
gb|BQ699741.1|BQ699741 NXRV128_C09_F NXRV (Nsf Xylem Root w... 76 5e-012
gb|BQ701255.1|BQ701255 NXSI_061_D08_F NXSI (Nsf Xylem Side ... 76 5e-012
gb|BQ702414.1|BQ702414 NXSI_128_D03_F NXSI (Nsf Xylem Side ... 76 5e-012
gb|CF391909.1|CF391909 RTDR3_10_A12.g1_A022 Loblolly pine r... 76 5e-012
gb|CF395486.1|CF395486 RTDS2_11_B10.g1_A021 Drought-stresse... 76 5e-012
gb|CF396545.1|CF396545 RTDS2_22_E05.g1_A021 Drought-stresse... 76 5e-012
gb|CF470481.1|CF470481 RTDS1_17_C04.g1_A015 Drought-stresse... 76 5e-012
gb|CF473126.1|CF473126 RTDS1_1_A10.g1_A015 Drought-stressed... 76 5e-012
gb|CF476223.1|CF476223 RTWW2_21_H07.g1_A021 Well-watered lo... 76 5e-012
gb|CF664576.1|CF664576 RTCNT1_10_E07.g1_A029 Root control P... 76 5e-012
gb|CF670337.1|CF670337 RTCNT1_49_C10.g1_A029 Root control P... 76 5e-012
gb|CO172000.1|CO172000 NDL1_26_H11.b1_A029 Needles control ... 76 5e-012
gb|CO199878.1|CO199878 GEO2_4_C04.b1_A032 Root gravitropism... 76 5e-012
gb|CO369202.1|CO369202 RTK1_45_D02.g1_A029 Roots minus pota... 76 5e-012
gb|CV032008.1|CV032008 RTNACL1_5_D05.b1_A029 Roots plus add... 76 5e-012
gb|CX648337.1|CX648337 COLD1_28_B08.b1_A029 Root cold Pinus... 76 5e-012
gb|CX652948.1|CX652948 COLD1_62_B02.g1_A029 Root cold Pinus... 76 5e-012
gb|DR020355.1|DR020355 STRS1_36_H06.b1_A034 Shoot tip pitch... 76 5e-012
gb|DR020425.1|DR020425 STRS1_36_H06.g1_A034 Shoot tip pitch... 76 5e-012
gb|DR023030.1|DR023030 STRS1_55_B12.b1_A034 Shoot tip pitch... 76 5e-012
gb|DR053466.1|DR053466 RTCA1_11_G10.b1_A029 Roots minus cal... 76 5e-012
gb|DR069742.1|DR069742 RTDK1_9_D10.b1_A029 Roots, dark Pinu... 76 5e-012
gb|DR077997.1|DR077997 RTFEPL1_1_G01.b1_A029 Roots plus add... 76 5e-012
gb|DR120850.1|DR120850 RTMG1_32_H05.b1_A029 Roots minus mag... 76 5e-012
gb|DR178053.1|DR178053 RTMNUT1_9_B04.b1_A029 Roots minus mi... 76 5e-012
gb|DR179407.1|DR179407 RTMNUT1_22_A02.b2_A029 Roots minus m... 76 5e-012
gb|DR180812.1|DR180812 RTMNUT1_35_B03.b1_A029 Roots minus m... 76 5e-012
gb|AY764803.1|AY764801S3 Pinus taeda isolate 16 cinnamate 4... 76 5e-012
gb|AY764807.1|AY764805S3 Pinus taeda isolate 6 cinnamate 4-... 76 5e-012
gb|AY764811.1|AY764809S3 Pinus taeda isolate 4 cinnamate 4-... 76 5e-012
gb|AY764815.1|AY764813S3 Pinus taeda isolate 26 cinnamate 4... 76 5e-012
gb|AY764819.1|AY764817S3 Pinus taeda isolate 9 cinnamate 4-... 76 5e-012
gb|AY764827.1|AY764825S3 Pinus taeda isolate 22 cinnamate 4... 76 5e-012
gb|AY764831.1|AY764829S3 Pinus taeda isolate 32 cinnamate 4... 76 5e-012
gb|AY764835.1|AY764833S3 Pinus taeda isolate 18 cinnamate 4... 76 5e-012
gb|AY764839.1|AY764837S3 Pinus taeda isolate 21 cinnamate 4... 76 5e-012
gb|AY764843.1|AY764841S3 Pinus taeda isolate 31 cinnamate 4... 76 5e-012
gb|AY764847.1|AY764845S3 Pinus taeda isolate 5 cinnamate 4-... 76 5e-012
gb|AY764851.1|AY764849S3 Pinus taeda isolate 15 cinnamate 4... 76 5e-012
gb|AY764855.1|AY764853S3 Pinus taeda isolate 20 cinnamate 4... 76 5e-012
gb|AY764863.1|AY764861S3 Pinus taeda isolate 24 cinnamate 4... 76 5e-012
gb|AY764867.1|AY764865S3 Pinus taeda isolate 11 cinnamate 4... 76 5e-012
gb|AY764871.1|AY764869S3 Pinus taeda isolate 7 cinnamate 4-... 76 5e-012
gb|AY764875.1|AY764873S3 Pinus taeda isolate 25 cinnamate 4... 76 5e-012
gb|AY764879.1|AY764877S3 Pinus taeda isolate 13 cinnamate 4... 76 5e-012
gb|AY764883.1|AY764881S3 Pinus taeda isolate 30 cinnamate 4... 76 5e-012
gb|AY764887.1|AY764885S3 Pinus taeda isolate 14 cinnamate 4... 76 5e-012
gb|AY764891.1|AY764889S3 Pinus taeda isolate 10 cinnamate 4... 76 5e-012
gb|AY764895.1|AY764893S3 Pinus taeda isolate 2 cinnamate 4-... 76 5e-012
gb|AY764899.1|AY764897S3 Pinus taeda isolate 3 cinnamate 4-... 76 5e-012
gb|AY764903.1|AY764901S3 Pinus taeda isolate 19 cinnamate 4... 76 5e-012
gb|AY764907.1|AY764905S3 Pinus taeda isolate 28 cinnamate 4... 76 5e-012
gb|AY764911.1|AY764909S3 Pinus taeda isolate 8 cinnamate 4-... 76 5e-012
gb|AY764915.1|AY764913S3 Pinus taeda isolate 17 cinnamate 4... 76 5e-012
gb|AY764919.1|AY764917S3 Pinus taeda isolate 1 cinnamate 4-... 76 5e-012
gb|AY764923.1|AY764921S3 Pinus taeda isolate 29 cinnamate 4... 76 5e-012
gb|AY764927.1|AY764925S3 Pinus taeda isolate 27 cinnamate 4... 76 5e-012
gb|BF220551.1|BF220551 NXCI_148_D07_F NXCI (Nsf Xylem Compr... 74 2e-011
gb|CF473580.1|CF473580 RTWW2_3_G09.g1_A021 Well-watered lob... 74 2e-011
gb|CO175438.1|CO175438 NDL1_54_F03.g1_A029 Needles control ... 74 2e-011
gb|DR743926.1|DR743926 RTCU1_19_C07.b1_A029 Roots plus adde... 74 2e-011
gb|BF049652.1|BF049652 NXCI_108_F05_F NXCI (Nsf Xylem Compr... 72 8e-011
gb|BF609556.1|BF609556 NXSI_046_B06_F NXSI (Nsf Xylem Side ... 72 8e-011
gb|BG275289.1|BG275289 NXSI_142_A01_F NXSI (Nsf Xylem Side ... 72 8e-011
gb|BQ699307.1|BQ699307 NXRV126_A09_F NXRV (Nsf Xylem Root w... 72 8e-011
gb|AW290024.1|AW290024 NXNV009G04F Nsf Xylem Normal wood Ve... 70 3e-010
gb|BX252947.1|BX252947 BX252947 Pinus pinaster differenciat... 70 3e-010
gb|BE241204.1|BE241204 NXNV_180_D03_F Nsf Xylem Normal wood... 70 3e-010
gb|BI644029.1|BI644029 NXPV_127_B12_F NXPV (Nsf Xylem Plani... 70 3e-010
gb|BQ696484.1|BQ696484 NXPV_041_G06_F NXPV (Nsf Xylem Plani... 70 3e-010
gb|BQ701829.1|BQ701829 NXSI_121_A07_F NXSI (Nsf Xylem Side ... 70 3e-010
gb|CD026691.1|CD026691 NXNV009G04 Nsf Xylem Normal wood Ver... 70 3e-010
gb|CF400820.1|CF400820 RTWW1_8_G10.b1_A015 Well-watered lob... 70 3e-010
gb|CF471221.1|CF471221 RTDS1_2_D09.b1_A015 Drought-stressed... 70 3e-010
gb|CF471858.1|CF471858 RTDS1_7_G12.b1_A015 Drought-stressed... 70 3e-010
gb|CF669934.1|CF669934 RTCNT1_47_B04.b1_A029 Root control P... 70 3e-010
gb|DN614015.1|DN614015 EST967065 Subtracted pine embryo lib... 70 3e-010
gb|DR059327.1|DR059327 RTNIT1_17_C03.b1_A029 Roots minus ni... 70 3e-010
gb|DR101584.1|DR101584 STRR1_74_H05.b1_A033 Stem Response R... 70 3e-010
gb|DR744974.1|DR744974 RTCU1_26_D05.b1_A029 Roots plus adde... 70 3e-010
gb|DR745352.1|DR745352 RTCU1_28_E12.g1_A029 Roots plus adde... 70 3e-010
gb|DT629014.1|DT629014 EST1155584 Subtracted pine embryo li... 70 3e-010
gb|CF389398.1|CF389398 RTDR2_7_E10.b1_A021 Loblolly pine ro... 68 1e-009
gb|CF402842.1|CF402842 RTWW1_23_D03.b1_A015 Well-watered lo... 68 1e-009
gb|CO160429.1|CO160429 FLD1_20_H12.g1_A029 Root flooded Pin... 68 1e-009
gb|CO198057.1|CO198057 GEO1_11_A08.b1_A029 Root gravitropis... 68 1e-009
gb|CX650723.1|CX650723 COLD1_47_E04.g1_A029 Root cold Pinus... 68 1e-009
gb|AY764823.1|AY764821S3 Pinus taeda isolate 23 cinnamate 4... 68 1e-009
gb|AY764859.1|AY764857S3 Pinus taeda isolate 12 cinnamate 4... 68 1e-009
gb|BF518351.1|BF518351 NXSI_038_D05_F NXSI (Nsf Xylem Side ... 66 5e-009
gb|CF397305.1|CF397305 RTDS3_2_F01.g1_A022 Drought-stressed... 66 5e-009
gb|CF479268.1|CF479268 RTWW3_23_E07.b1_A022 Well-watered lo... 66 5e-009
gb|BX249390.1|BX249390 BX249390 Pinus pinaster differenciat... 64 2e-008
gb|BE997078.1|BE997078 NXCI_098_F08_F NXCI (Nsf Xylem Compr... 64 2e-008
gb|BF060586.1|BF060586 NXCI_117_C04_F NXCI (Nsf Xylem Compr... 64 2e-008
gb|BQ699654.1|BQ699654 NXRV125_B02_F NXRV (Nsf Xylem Root w... 64 2e-008
gb|CF387404.1|CF387404 RTDR1_12_C07.g1_A015 Loblolly pine r... 64 2e-008
gb|CF387868.1|CF387868 RTDR1_18_A04.g1_A015 Loblolly pine r... 64 2e-008
gb|CF388062.1|CF388062 RTDR1_17_F06.g1_A015 Loblolly pine r... 64 2e-008
gb|CF400054.1|CF400054 RTWW1_2_F08.g1_A015 Well-watered lob... 64 2e-008
gb|CF401119.1|CF401119 RTWW1_10_E09.b1_A015 Well-watered lo... 64 2e-008
gb|CF401623.1|CF401623 RTWW1_13_H09.g1_A015 Well-watered lo... 64 2e-008
gb|CF402320.1|CF402320 RTWW1_19_F11.g1_A015 Well-watered lo... 64 2e-008
gb|CF470644.1|CF470644 RTDS1_13_G10.g1_A015 Drought-stresse... 64 2e-008
gb|CF667804.1|CF667804 RTCNT1_32_D04.g1_A029 Root control P... 64 2e-008
gb|CF671508.1|CF671508 RTCNT1_57_C07.g1_A029 Root control P... 64 2e-008
gb|CO159507.1|CO159507 FLD1_14_B09.b1_A029 Root flooded Pin... 64 2e-008
gb|CO165799.1|CO165799 FLD1_57_E01.b1_A029 Root flooded Pin... 64 2e-008
gb|CO165865.1|CO165865 FLD1_57_E01.g1_A029 Root flooded Pin... 64 2e-008
gb|CO166855.1|CO166855 FLD1_65_B06.b1_A029 Root flooded Pin... 64 2e-008
gb|CO413403.1|CO413403 EST843788 Sequencing ESTs from loblo... 64 2e-008
gb|CX715394.1|CX715394 RTPQ1_33_H02.g1_A032 Roots treated w... 64 2e-008
gb|DN455881.1|DN455881 EST951680 Sequencing ESTs from loblo... 64 2e-008
gb|DR049736.1|DR049736 RTBOR1_18_E10.g1_A029 Roots plus add... 64 2e-008
gb|DR089135.1|DR089135 RTAL1_6_F04.g1_A029 Roots plus added... 64 2e-008
gb|DR117513.1|DR117513 RTMG1_7_A05.g1_A029 Roots minus magn... 64 2e-008
gb|DR385758.1|DR385758 RTHG1_10_E04.g1_A029 Roots plus adde... 64 2e-008
gb|DR683978.1|DR683978 EST1074054 Normalized pine embryo li... 64 2e-008
gb|DT625214.1|DT625214 EST1159489 Sequencing ESTs from lobl... 64 2e-008
gb|BE186963.1|BE186963 NXNV_158_G09_F Nsf Xylem Normal wood... 62 8e-008
gb|BF169900.1|BF169900 NXCI_127_G11_F NXCI (Nsf Xylem Compr... 62 8e-008
gb|DN615192.1|DN615192 EST968242 Subtracted pine embryo lib... 62 8e-008
gb|DT629571.1|DT629571 EST1156141 Subtracted pine embryo li... 62 8e-008
gb|AI812813.1|AI812813 19E5 Pine Lambda Zap Xylem library P... 60 3e-007
gb|AW290693.1|AW290693 NXNV045D12F Nsf Xylem Normal wood Ve... 60 3e-007
gb|BX254605.1|BX254605 BX254605 Pinus pinaster differenciat... 60 3e-007
gb|CD027355.1|CD027355 NXNV045D12 Nsf Xylem Normal wood Ver... 60 3e-007
gb|DR385324.1|DR385324 RTHG1_8_A11.b1_A029 Roots plus added... 60 3e-007
gb|BX255059.1|BX255059 BX255059 Pinus pinaster differenciat... 58 1e-006
gb|CF397587.1|CF397587 RTDS3_4_B03.g1_A022 Drought-stressed... 58 1e-006
gb|BM427766.1|BM427766 NXRV_003_A06_F NXRV (Nsf Xylem Root ... 56 5e-006
gb|CD024164.1|CD024164 NXRV_034_H10_F NXRV (Nsf Xylem Root ... 56 5e-006
gb|CF477753.1|CF477753 RTWW3_9_C03.g1_A022 Well-watered lob... 56 5e-006
gb|BX678013.1|BX678013 BX678013 RN Pinus pinaster cDNA clon... 56 5e-006
gb|CR354679.1|CR354679 CR354679 Pinus pinaster differenciat... 56 5e-006
gb|CV146907.1|CV146907 EST858116 Sequencing ESTs from loblo... 56 5e-006
gb|BF049678.1|BF049678 NXCI_109_C08_F NXCI (Nsf Xylem Compr... 54 2e-005
gb|BG275454.1|BG275454 NXSI_139_A03_F NXSI (Nsf Xylem Side ... 54 2e-005
gb|CD025167.1|CD025167 NXSI_025_B09_F NXSI (Nsf Xylem Side ... 54 2e-005
gb|CF390012.1|CF390012 RTDR2_11_H02.g1_A021 Loblolly pine r... 54 2e-005
gb|CO367289.1|CO367289 RTK1_33_H10.b1_A029 Roots minus pota... 54 2e-005
gb|DR095332.1|DR095332 STRR1_20_H02.b1_A033 Stem Response R... 54 2e-005
gb|BF610369.1|BF610369 NXSI_049_E11_F NXSI (Nsf Xylem Side ... 52 8e-005
gb|CF666119.1|CF666119 RTCNT1_21_A01.b1_A029 Root control P... 52 8e-005
gb|CO171166.1|CO171166 NDL1_19_D03.g1_A029 Needles control ... 52 8e-005
gb|BG275390.1|BG275390 NXSI_141_C04_F NXSI (Nsf Xylem Side ... 50 3e-004
gb|CF473017.1|CF473017 RTDS1_1_A10.b1_A015 Drought-stressed... 50 3e-004
gb|CV137192.1|CV137192 EST848401 Sequencing ESTs from loblo... 50 3e-004
gb|BX251017.1|BX251017 BX251017 Pinus pinaster differenciat... 48 0.001
gb|CF393821.1|CF393821 RTDS2_1_E11.g1_A021 Drought-stressed... 48 0.001
gb|CF478231.1|CF478231 RTWW3_19_B02.g1_A022 Well-watered lo... 48 0.001
gb|CF478379.1|CF478379 RTWW3_18_E03.g1_A022 Well-watered lo... 48 0.001
gb|CF666179.1|CF666179 RTCNT1_21_A01.g1_A029 Root control P... 48 0.001
gb|CN784142.1|CN784142 EST782833 Sequencing ESTs from loblo... 48 0.001
gb|CO410556.1|CO410556 EST840941 Sequencing ESTs from loblo... 48 0.001
gb|CO412560.1|CO412560 EST842945 Sequencing ESTs from loblo... 48 0.001
gb|CO364291.1|CO364291 RTK1_14_G10.g1_A029 Roots minus pota... 48 0.001
gb|CX650872.1|CX650872 COLD1_48_D10.g1_A029 Root cold Pinus... 48 0.001
gb|DN449749.1|DN449749 EST945548 Sequencing ESTs from loblo... 48 0.001
gb|DN449945.1|DN449945 EST945744 Sequencing ESTs from loblo... 48 0.001
gb|DN455811.1|DN455811 EST951610 Sequencing ESTs from loblo... 48 0.001
gb|DN456679.1|DN456679 EST952478 Sequencing ESTs from loblo... 48 0.001
gb|DN465027.1|DN465027 EST960826 Sequencing ESTs from loblo... 48 0.001
gb|DR014011.1|DR014011 HEAT1_22_H03.g1_A029 Root at 37 C fo... 48 0.001
gb|DR022327.1|DR022327 STRS1_50_G11.b1_A034 Shoot tip pitch... 48 0.001
gb|DR024815.1|DR024815 STRS1_67_D06.g1_A034 Shoot tip pitch... 48 0.001
gb|DR047818.1|DR047818 RTBOR1_3_F06.g1_A029 Roots plus adde... 48 0.001
gb|DR089050.1|DR089050 RTAL1_6_F04.b1_A029 Roots plus added... 48 0.001
gb|DR097814.1|DR097814 STRR1_37_E08.b1_A033 Stem Response R... 48 0.001
gb|DR097886.1|DR097886 STRR1_37_E08.g1_A033 Stem Response R... 48 0.001
gb|DR100503.1|DR100503 STRR1_64_D06.g1_A033 Stem Response R... 48 0.001
gb|DR101946.1|DR101946 STRR1_76_H05.g1_A033 Stem Response R... 48 0.001
gb|DR102377.1|DR102377 STRR1_80_E01.g1_A033 Stem Response R... 48 0.001
gb|DR385683.1|DR385683 RTHG1_10_E04.b1_A029 Roots plus adde... 48 0.001
gb|DT625816.1|DT625816 EST1157740 Sequencing ESTs from lobl... 48 0.001
gb|AY670364.1| Pinus taeda isolate 4 trans-cinnamate 4-hydr... 48 0.001
gb|AY670365.1| Pinus taeda isolate 26 trans-cinnamate 4-hyd... 48 0.001
gb|AY670369.1| Pinus taeda isolate 32 trans-cinnamate 4-hyd... 48 0.001
gb|AY670373.1| Pinus taeda isolate 31 trans-cinnamate 4-hyd... 48 0.001
gb|AY670374.1| Pinus taeda isolate 5 trans-cinnamate 4-hydr... 48 0.001
gb|AY670378.1| Pinus taeda isolate 11 trans-cinnamate 4-hyd... 48 0.001
gb|AY670379.1| Pinus taeda isolate 7 trans-cinnamate 4-hydr... 48 0.001
gb|AY670385.1| Pinus taeda isolate 2 trans-cinnamate 4-hydr... 48 0.001
gb|AY670386.1| Pinus taeda isolate 3 trans-cinnamate 4-hydr... 48 0.001
gb|AY670387.1| Pinus taeda isolate 19 trans-cinnamate 4-hyd... 48 0.001
gb|AY670389.1| Pinus taeda isolate 8 trans-cinnamate 4-hydr... 48 0.001
gb|AY670392.1| Pinus taeda isolate 29 trans-cinnamate 4-hyd... 48 0.001
gb|CO198441.1|CO198441 GEO1_13_E11.g1_A029 Root gravitropis... 46 0.005
gb|DR024734.1|DR024734 STRS1_67_D06.b1_A034 Shoot tip pitch... 46 0.005
gb|AW736813.1|AW736813 NXNV_083_C04_F Nsf Xylem Normal wood... 44 0.019
gb|BF049679.1|BF049679 NXCI_109_C11_F NXCI (Nsf Xylem Compr... 44 0.019
gb|BF778706.1|BF778706 NXSI_086_A11_F NXSI (Nsf Xylem Side ... 44 0.019
gb|BQ699918.1|BQ699918 NXRV131_D06_F NXRV (Nsf Xylem Root w... 44 0.019
gb|CD016854.1|CD016854 NXCI_062_C09_F NXCI (Nsf Xylem Compr... 44 0.019
gb|CD020313.1|CD020313 NXNV056G10 Nsf Xylem Normal wood Ver... 44 0.019
gb|CD021604.1|CD021604 NXNV_156_C06_F Nsf Xylem Normal wood... 44 0.019
gb|CD025384.1|CD025384 NXSI_050_E07_F NXSI (Nsf Xylem Side ... 44 0.019
gb|CF385224.1|CF385224 RTDR1_2_E01.g1_A015 Loblolly pine ro... 44 0.019
gb|CF385572.1|CF385572 RTDR1_4_A06.g1_A015 Loblolly pine ro... 44 0.019
gb|CF387165.1|CF387165 RTDR1_11_A09.b1_A015 Loblolly pine r... 44 0.019
gb|CF387668.1|CF387668 RTDR1_19_A10.b1_A015 Loblolly pine r... 44 0.019
gb|CF394836.1|CF394836 RTDS2_8_G08.b1_A021 Drought-stressed... 44 0.019
gb|CF394939.1|CF394939 RTDS2_8_G08.g1_A021 Drought-stressed... 44 0.019
gb|CF395347.1|CF395347 RTDS2_11_B10.b1_A021 Drought-stresse... 44 0.019
gb|CF401106.1|CF401106 RTWW1_10_F06.b1_A015 Well-watered lo... 44 0.019
gb|CF470397.1|CF470397 RTDS1_17_C04.b1_A015 Drought-stresse... 44 0.019
gb|CF472357.1|CF472357 RTDS1_9_G03.b1_A015 Drought-stressed... 44 0.019
gb|CF472453.1|CF472453 RTDS1_9_G03.g1_A015 Drought-stressed... 44 0.019
gb|CF473488.1|CF473488 RTWW2_3_G09.b2_A021 Well-watered lob... 44 0.019
gb|CF476268.1|CF476268 RTWW2_22_D04.b1_A021 Well-watered lo... 44 0.019
gb|CF477477.1|CF477477 RTWW3_8_G12.b1_A022 Well-watered lob... 44 0.019
gb|CF477602.1|CF477602 RTWW3_8_G12.g1_A022 Well-watered lob... 44 0.019
gb|CF665311.1|CF665311 RTCNT1_15_F02.b1_A029 Root control P... 44 0.019
gb|CF669309.1|CF669309 RTCNT1_42_F10.b1_A029 Root control P... 44 0.019
gb|CF670072.1|CF670072 RTCNT1_48_A01.b1_A029 Root control P... 44 0.019
gb|CF672794.1|CF672794 RTCNT1_74_B01.b1_A029 Root control P... 44 0.019
gb|CV035578.1|CV035578 RTNACL1_41_B03.b1_A029 Roots plus ad... 44 0.019
gb|CV035589.1|CV035589 RTNACL1_41_C03.b1_A029 Roots plus ad... 44 0.019
gb|CX648959.1|CX648959 COLD1_32_B09.b1_A029 Root cold Pinus... 44 0.019
gb|CX649036.1|CX649036 COLD1_32_B09.g1_A029 Root cold Pinus... 44 0.019
gb|DR016415.1|DR016415 STRS1_10_A08.b1_A034 Shoot tip pitch... 44 0.019
gb|DR016492.1|DR016492 STRS1_10_A08.g1_A034 Shoot tip pitch... 44 0.019
gb|DR078405.1|DR078405 RTFEPL1_4_A11.b1_A029 Roots plus add... 44 0.019
gb|DR088359.1|DR088359 RTAL1_1_D08.b1_A029 Roots plus added... 44 0.019
gb|DR094342.1|DR094342 STRR1_14_A07.b1_A033 Stem Response R... 44 0.019
gb|DR098077.1|DR098077 STRR1_39_A09.b1_A033 Stem Response R... 44 0.019
gb|DR388433.1|DR388433 RTHG1_28_F03.b1_A029 Roots plus adde... 44 0.019
gb|AY764802.1|AY764801S2 Pinus taeda isolate 16 cinnamate 4... 44 0.019
gb|AY764806.1|AY764805S2 Pinus taeda isolate 6 cinnamate 4-... 44 0.019
gb|AY764810.1|AY764809S2 Pinus taeda isolate 4 cinnamate 4-... 44 0.019
gb|AY764814.1|AY764813S2 Pinus taeda isolate 26 cinnamate 4... 44 0.019
gb|AY764818.1|AY764817S2 Pinus taeda isolate 9 cinnamate 4-... 44 0.019
gb|AY764822.1|AY764821S2 Pinus taeda isolate 23 cinnamate 4... 44 0.019
gb|AY764826.1|AY764825S2 Pinus taeda isolate 22 cinnamate 4... 44 0.019
gb|AY764830.1|AY764829S2 Pinus taeda isolate 32 cinnamate 4... 44 0.019
gb|AY764834.1|AY764833S2 Pinus taeda isolate 18 cinnamate 4... 44 0.019
gb|AY764838.1|AY764837S2 Pinus taeda isolate 21 cinnamate 4... 44 0.019
gb|AY764842.1|AY764841S2 Pinus taeda isolate 31 cinnamate 4... 44 0.019
gb|AY764846.1|AY764845S2 Pinus taeda isolate 5 cinnamate 4-... 44 0.019
gb|AY764850.1|AY764849S2 Pinus taeda isolate 15 cinnamate 4... 44 0.019
gb|AY764854.1|AY764853S2 Pinus taeda isolate 20 cinnamate 4... 44 0.019
gb|AY764858.1|AY764857S2 Pinus taeda isolate 12 cinnamate 4... 44 0.019
gb|AY764862.1|AY764861S2 Pinus taeda isolate 24 cinnamate 4... 44 0.019
gb|AY764866.1|AY764865S2 Pinus taeda isolate 11 cinnamate 4... 44 0.019
gb|AY764870.1|AY764869S2 Pinus taeda isolate 7 cinnamate 4-... 44 0.019
gb|AY764874.1|AY764873S2 Pinus taeda isolate 25 cinnamate 4... 44 0.019
gb|AY764878.1|AY764877S2 Pinus taeda isolate 13 cinnamate 4... 44 0.019
gb|AY764882.1|AY764881S2 Pinus taeda isolate 30 cinnamate 4... 44 0.019
gb|AY764886.1|AY764885S2 Pinus taeda isolate 14 cinnamate 4... 44 0.019
gb|AY764890.1|AY764889S2 Pinus taeda isolate 10 cinnamate 4... 44 0.019
gb|AY764894.1|AY764893S2 Pinus taeda isolate 2 cinnamate 4-... 44 0.019
gb|AY764898.1|AY764897S2 Pinus taeda isolate 3 cinnamate 4-... 44 0.019
gb|AY764902.1|AY764901S2 Pinus taeda isolate 19 cinnamate 4... 44 0.019
gb|AY764906.1|AY764905S2 Pinus taeda isolate 28 cinnamate 4... 44 0.019
gb|AY764910.1|AY764909S2 Pinus taeda isolate 8 cinnamate 4-... 44 0.019
gb|AY764914.1|AY764913S2 Pinus taeda isolate 17 cinnamate 4... 44 0.019
gb|AY764918.1|AY764917S2 Pinus taeda isolate 1 cinnamate 4-... 44 0.019
gb|AY764922.1|AY764921S2 Pinus taeda isolate 29 cinnamate 4... 44 0.019
gb|AY764926.1|AY764925S2 Pinus taeda isolate 27 cinnamate 4... 44 0.019
gb|AW495794.1|AW495794 NXNV_065_E05_FF Nsf Xylem Normal woo... 42 0.073
gb|BF778063.1|BF778063 NXSI_081_E04_F NXSI (Nsf Xylem Side ... 42 0.073
gb|CD016258.1|CD016258 NXCI_031_D12_F NXCI (Nsf Xylem Compr... 42 0.073
gb|CD027751.1|CD027751 NXNV_065_E05_F Nsf Xylem Normal wood... 42 0.073
gb|DR017352.1|DR017352 STRS1_15_F03.g1_A034 Shoot tip pitch... 42 0.073
gb|DR023109.1|DR023109 STRS1_55_B12.g1_A034 Shoot tip pitch... 42 0.073
gb|BQ700232.1|BQ700232 NXRV103_A02_F NXRV (Nsf Xylem Root w... 40 0.29
gb|CD020610.1|CD020610 NXNV_081_D03_F Nsf Xylem Normal wood... 40 0.29
gb|CF387928.1|CF387928 RTDR1_17_F06.b1_A015 Loblolly pine r... 40 0.29
gb|CF399964.1|CF399964 RTWW1_2_F08.b1_A015 Well-watered lob... 40 0.29
gb|CF471814.1|CF471814 RTDS1_6_C12.g1_A015 Drought-stressed... 40 0.29
gb|CF472578.1|CF472578 RTDS1_10_F09.g1_A015 Drought-stresse... 40 0.29
gb|CF476072.1|CF476072 RTWW2_16_C01.g1_A021 Well-watered lo... 40 0.29
gb|CF477371.1|CF477371 RTWW3_7_H02.b1_A022 Well-watered lob... 40 0.29
gb|CF478190.1|CF478190 RTWW3_19_H01.g1_A022 Well-watered lo... 40 0.29
>gb|CF669075.1|CF669075 RTCNT1_40_B01.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_40_B01_A029 5', mRNA sequence
Length = 634
Score = 202 bits (102), Expect = 3e-050
Identities = 171/194 (88%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 451 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 392
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 391 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 332
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| |||||||| |
Sbjct: 331 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagctccggcgat 272
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 271 gacaccacaaccag 258
Score = 40.1 bits (20), Expect = 0.29
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 1077 aagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatgcggaacatgtcgttg 1136
||||||||||||| |||||| ||||| || | ||| ||||| || | | ||||| |||
Sbjct: 634 aagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatcctgtacatgatgtta 575
Query: 1137 tacatcatcagctggaggcg 1156
||||||| |||||| |||||
Sbjct: 574 tacatcaccagctgcaggcg 555
>gb|CF672446.1|CF672446 RTCNT1_63_D08.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_63_D08_A029 5', mRNA sequence
Length = 720
Score = 202 bits (102), Expect = 3e-050
Identities = 171/194 (88%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 453 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 394
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 393 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 334
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| |||||||| |
Sbjct: 333 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagctccggcgat 274
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 273 gacaccacaaccag 260
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 711 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 652
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 651 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 592
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 591 ctgtacatgatgttatacatcaccagctgcaggcg 557
>gb|CO198374.1|CO198374 GEO1_13_E11.b1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_13_E11_A029 3', mRNA sequence
Length = 805
Score = 202 bits (102), Expect = 3e-050
Identities = 171/194 (88%)
Strand = Plus / Plus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 353 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 412
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 413 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 472
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| |||||||| |
Sbjct: 473 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagctccggcgat 532
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 533 gacaccacaaccag 546
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Plus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 95 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 154
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 155 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 214
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 215 ctgtacatgatgttatacatcaccagctgcaggcg 249
>gb|CO367203.1|CO367203 RTK1_32_G09.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_32_G09_A029 5', mRNA sequence
Length = 832
Score = 202 bits (102), Expect = 3e-050
Identities = 171/194 (88%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 455 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 396
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 395 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 336
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| |||||||| |
Sbjct: 335 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagctccggcgat 276
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 275 gacaccacaaccag 262
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 713 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 654
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 653 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 594
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 593 ctgtacatgatgttatacatcaccagctgcaggcg 559
>gb|CV137929.1|CV137929 EST849138 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIAW43 5' end, mRNA sequence
Length = 945
Score = 202 bits (102), Expect = 3e-050
Identities = 171/194 (88%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 205 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 146
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||
Sbjct: 145 tacaccgtgaacaccatgtcctgccccttccccgtgaatatgtcgaacaccacgttccga 86
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| | ||||||||||| |||||||| |
Sbjct: 85 gtccgcgacccgaactccaccccctgcgtgtgcaaaacctccttggcgagctccggcgat 26
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 25 gacaccacaaccag 12
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 463 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 404
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 403 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 344
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 343 ctgtacatgatgttatacatcaccagctgcaggcg 309
Score = 56.0 bits (28), Expect = 5e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 720 gggtggttcaccagctcggcgatgccccactcgatcgaccacagtgtcgtctcgatcgct 779
||||||||||| | ||||||| ||||| || || ||||| | || |||||||| |||
Sbjct: 757 gggtggttcacgatttcggcgagtccccattccatggaccataaagttgtctcgattgct 698
Query: 780 gcgacgttgatgttctcgacgatgtagaggacgttgtcgtggttgatctcgccctt 835
|| || || |||||||| |||||||||||||| ||||| | ||| || ||||||||
Sbjct: 697 gcaacattaatgttctccacgatgtagaggacattgtcttcgtttatttcgccctt 642
>gb|DN459740.1|DN459740 EST955539 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIHQ49 5' end, mRNA sequence
Length = 848
Score = 202 bits (102), Expect = 3e-050
Identities = 171/194 (88%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 429 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 370
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 369 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 310
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| |||||||| |
Sbjct: 309 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagctccggcgat 250
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 249 gacaccacaaccag 236
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 687 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 628
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 627 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 568
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 567 ctgtacatgatgttatacatcaccagctgcaggcg 533
>gb|CF479694.1|CF479694 RTWW3_11_A12.g1_A022 Well-watered loblolly pine roots WW3 Pinus taeda
cDNA clone RTWW3_11_A12_A022 5', mRNA sequence
Length = 584
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 200 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 141
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 140 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 81
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 80 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 21
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 20 gacaccacaaccag 7
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 458 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 399
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 398 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 339
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 338 ctgtacatgatgttatacatcaccagctgcaggcg 304
>gb|CO366112.1|CO366112 RTK1_25_H12.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_25_H12_A029 5', mRNA sequence
Length = 766
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 235 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 176
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 175 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 116
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 115 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 56
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 55 gacaccacaaccag 42
Score = 63.9 bits (32), Expect = 2e-008
Identities = 59/68 (86%)
Strand = Plus / Minus
Query: 768 gtctcgatcgctgcgacgttgatgttctcgacgatgtagaggacgttgtcgtggttgatc 827
|||||||| ||||| || || |||||||| |||||||||||||| ||||| | ||||||
Sbjct: 739 gtctcgattgctgcaacattaatgttctccacgatgtagaggacattgtcttcgttgatt 680
Query: 828 tcgccctt 835
||||||||
Sbjct: 679 tcgccctt 672
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 493 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 434
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 433 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 374
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 373 ctgtacatgatgttatacatcaccagctgcaggcg 339
>gb|CV137016.1|CV137016 EST848225 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIAJ16 5' end, mRNA sequence
Length = 806
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 488 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 429
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 428 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 369
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 368 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 309
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 308 gacaccacaaccag 295
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 746 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 687
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 686 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 627
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 626 ctgtacatgatgttatacatcaccagctgcaggcg 592
>gb|CV145292.1|CV145292 EST856501 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIDG68 5' end, mRNA sequence
Length = 912
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 692 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 633
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 632 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 573
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 572 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 513
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 512 gacaccacaaccag 499
Score = 42.1 bits (21), Expect = 0.073
Identities = 66/81 (81%)
Strand = Plus / Minus
Query: 1076 gaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatgcggaacatgtcgtt 1135
|||||||||||||| |||||| ||||| || | ||| ||||| || | | ||||| |||
Sbjct: 876 gaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatcctgtacatgatgtt 817
Query: 1136 gtacatcatcagctggaggcg 1156
||||||| |||||| |||||
Sbjct: 816 atacatcaccagctgcaggcg 796
>gb|CV148003.1|CV148003 EST859212 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIED52 5' end, mRNA sequence
Length = 752
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 486 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 427
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 426 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 367
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 366 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 307
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 306 gacaccacaaccag 293
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 744 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 685
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 684 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 625
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 624 ctgtacatgatgttatacatcaccagctgcaggcg 590
>gb|DN458423.1|DN458423 EST954222 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIHB77 5' end, mRNA sequence
Length = 923
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 488 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 429
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 428 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 369
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 368 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 309
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 308 gacaccacaaccag 295
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 746 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 687
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 686 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 627
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 626 ctgtacatgatgttatacatcaccagctgcaggcg 592
>gb|DN459149.1|DN459149 EST954948 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIHJ89 5' end, mRNA sequence
Length = 918
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 488 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 429
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 428 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 369
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 368 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 309
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 308 gacaccacaaccag 295
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 746 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 687
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 686 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 627
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 626 ctgtacatgatgttatacatcaccagctgcaggcg 592
>gb|DN460431.1|DN460431 EST956230 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIHY47 5' end, mRNA sequence
Length = 780
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 268 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 209
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 208 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 149
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 148 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 89
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 88 gacaccacaaccag 75
Score = 75.8 bits (38), Expect = 5e-012
Identities = 86/102 (84%)
Strand = Plus / Minus
Query: 768 gtctcgatcgctgcgacgttgatgttctcgacgatgtagaggacgttgtcgtggttgatc 827
|||||||| ||||| || || |||||||| |||||||||||||| ||||| | ||||||
Sbjct: 772 gtctcgattgctgcaacattaatgttctccacgatgtagaggacattgtcttcgttgatt 713
Query: 828 tcgcccttcctctcggcctcgaggatgtgatccatggcgcac 869
||||||||| ||| || |||| ||||||||| || ||||||
Sbjct: 712 tcgcccttctcctcagcttcgaagatgtgatcaatagcgcac 671
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 526 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 467
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 466 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 407
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 406 ctgtacatgatgttatacatcaccagctgcaggcg 372
>gb|DR048562.1|DR048562 RTBOR1_9_E10.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_9_E10_A029 5', mRNA sequence
Length = 376
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 347 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 288
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 287 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 228
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 227 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 168
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 167 gacaccacaaccag 154
>gb|DR051105.1|DR051105 RTBOR1_27_E08.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_27_E08_A029 5', mRNA sequence
Length = 686
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Plus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 471 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 530
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 531 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 590
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 591 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 650
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 651 gacaccacaaccag 664
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Plus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 213 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 272
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 273 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 332
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 333 ctgtacatgatgttatacatcaccagctgcaggcg 367
>gb|DR081268.1|DR081268 RTFEPL1_28_B04.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_28_B04_A029 5', mRNA sequence
Length = 736
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 476 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 417
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 416 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 357
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 356 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 297
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 296 gacaccacaaccag 283
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 734 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 675
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 674 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 615
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 614 ctgtacatgatgttatacatcaccagctgcaggcg 580
>gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (TC4H) mRNA, complete cds
Length = 1996
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 505 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 446
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 445 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 386
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| || ||||| |
Sbjct: 385 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccggcgat 326
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 325 gacaccacaaccag 312
Score = 75.8 bits (38), Expect = 5e-012
Identities = 122/150 (81%)
Strand = Plus / Minus
Query: 720 gggtggttcaccagctcggcgatgccccactcgatcgaccacagtgtcgtctcgatcgct 779
||||||||||| | ||||||| ||||| || || ||||| | || |||||||| |||
Sbjct: 1057 gggtggttcacgatttcggcgagtccccattccatggaccataaagttgtctcgattgct 998
Query: 780 gcgacgttgatgttctcgacgatgtagaggacgttgtcgtggttgatctcgcccttcctc 839
|| || || |||||||| |||||||||||||| ||||| | |||||| ||||||||| |
Sbjct: 997 gcaacattaatgttctccacgatgtagaggacattgtcttcgttgatttcgcccttctcc 938
Query: 840 tcggcctcgaggatgtgatccatggcgcac 869
|| || |||| ||||||||| || ||||||
Sbjct: 937 tcagcttcgaagatgtgatcaatagcgcac 908
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 763 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 704
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 703 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 644
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 643 ctgtacatgatgttatacatcaccagctgcaggcg 609
Score = 40.1 bits (20), Expect = 0.29
Identities = 89/112 (79%)
Strand = Plus / Minus
Query: 482 gttggcgaggaaccaggcattgacgaggatcttggactcggcggggatgtcgtagccggc 541
|||||| || ||||||||||| || || || ||| ||||| || |||||||||||| |
Sbjct: 1295 gttggccagaaaccaggcattcaccagtattttgctttcggccggaatgtcgtagccgcc 1236
Query: 542 gagcttgccgtcgttgaggttcatgtgggggaccagcagcgggatggccatg 593
||||||| | | || ||||||||||| || || ||||| || || ||||||
Sbjct: 1235 gagcttggcctggtgaaggttcatgtgaggcacaagcaggggaatcgccatg 1184
>emb|BX784398.1| Pinus pinaster STS PPC4HP1, sequence tagged site
Length = 550
Score = 194 bits (98), Expect = 8e-048
Identities = 170/194 (87%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 460 accttgttggtaaagaagggcactgtcatgatccgccgcatcttccgccaatgctcgccg 401
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||| ||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 400 tacaccgtgaacaccatatcctgccccttccccgtgaatatatcgaacaccacgttccga 341
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccggggtc 1439
|| || || ||||||||||| ||||||||||| || ||||||||||| |||||||| |
Sbjct: 340 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagctccggcgat 281
Query: 1440 gacaccaccaccag 1453
|||||||| |||||
Sbjct: 280 gacaccacaaccag 267
>gb|BX681070.1|BX681070 BX681070 RS Pinus pinaster cDNA clone RS52G08, mRNA sequence
Length = 250
Score = 192 bits (97), Expect = 3e-047
Identities = 154/173 (89%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 181 accttgttggtaaagaagggcactgtcatgatccgccgcatcttccgccaatgctcgccg 122
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 121 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 62
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctc 1432
|| || || ||||||||||| ||||||||||| || ||||||||||| |||||
Sbjct: 61 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagctc 9
>gb|CF386137.1|CF386137 RTDR1_8_D09.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_8_D09_A015 5', mRNA sequence
Length = 707
Score = 190 bits (96), Expect = 1e-046
Identities = 156/176 (88%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 207 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 148
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 147 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 88
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccgg 1435
|| || || ||||||||||| ||||||||||| || ||||||||||| || |||||
Sbjct: 87 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccgg 32
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 465 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 406
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 405 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 346
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 345 ctgtacatgatgttatacatcaccagctgcaggcg 311
Score = 56.0 bits (28), Expect = 5e-006
Identities = 55/64 (85%)
Strand = Plus / Minus
Query: 772 cgatcgctgcgacgttgatgttctcgacgatgtagaggacgttgtcgtggttgatctcgc 831
|||| ||||| || || |||||||| |||||||||||||| ||||| | |||||| ||||
Sbjct: 707 cgattgctgcaacattaatgttctccacgatgtagaggacattgtcttcgttgatttcgc 648
Query: 832 cctt 835
||||
Sbjct: 647 cctt 644
>gb|CF386488.1|CF386488 RTDR1_14_G02.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_14_G02_A015 5', mRNA
sequence
Length = 682
Score = 190 bits (96), Expect = 1e-046
Identities = 156/176 (88%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 186 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 127
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 126 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 67
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggccagctccgg 1435
|| || || ||||||||||| ||||||||||| || ||||||||||| || |||||
Sbjct: 66 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggcgagatccgg 11
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 444 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 385
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 384 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 325
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 324 ctgtacatgatgttatacatcaccagctgcaggcg 290
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 789 atgttctcgacgatgtagaggacgttgtcgtggttgatctcgccctt 835
|||||||| |||||||||||||| ||||| | |||||| ||||||||
Sbjct: 669 atgttctccacgatgtagaggacattgtcttcgttgatttcgccctt 623
>gb|CV137537.1|CV137537 EST848746 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIAP73 5' end, mRNA sequence
Length = 481
Score = 188 bits (95), Expect = 5e-046
Identities = 149/167 (89%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 168 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 109
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 108 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 49
Query: 1380 gtgcgggagccgaactccacgccctgcgtgtggagcacctccttggc 1426
|| || || ||||||||||| ||||||||||| || |||||||||||
Sbjct: 48 gtccgcgacccgaactccaccccctgcgtgtgcagaacctccttggc 2
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 426 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 367
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 366 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 307
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 306 ctgtacatgatgttatacatcaccagctgcaggcg 272
>gb|CX648893.1|CX648893 COLD1_31_D03.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_31_D03_A029 5', mRNA sequence
Length = 518
Score = 188 bits (95), Expect = 5e-046
Identities = 171/195 (87%), Gaps = 1/195 (0%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 286 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 227
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 226 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 167
Query: 1380 gtgcgggagccgaactc-cacgccctgcgtgtggagcacctccttggccagctccggggt 1438
|| || || |||||||| ||| ||||||||||| || ||||||||||| |||||||| |
Sbjct: 166 gtccgcgacccgaactcacaccccctgcgtgtgcagaacctccttggcgagctccggcga 107
Query: 1439 cgacaccaccaccag 1453
|||||||| |||||
Sbjct: 106 tgacaccacaaccag 92
>gb|DR091337.1|DR091337 RTAL1_20_H12.g1_A029 Roots plus added aluminum Pinus taeda cDNA clone
RTAL1_20_H12_A029 5', mRNA sequence
Length = 247
Score = 170 bits (86), Expect = 1e-040
Identities = 158/182 (86%)
Strand = Plus / Minus
Query: 1272 aagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccgtacaccgtgaac 1331
|||||||| || |||||||| ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 246 aagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccgtacaccgtgaac 187
Query: 1332 accatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgggtgcgggagccg 1391
||||||||||||||||| |||||||| || |||||||||||||| || || || || |||
Sbjct: 186 accatgtcctgccccttccccgtgaatatatcgaacaccacgttccgagtccgcgacccg 127
Query: 1392 aactccacgccctgcgtgtggagcacctccttggccagctccggggtcgacaccaccacc 1451
|||||||| |||||| |||| || ||||||||||| || ||||| | |||||||| |||
Sbjct: 126 aactccaccccctgcatgtgcagaacctccttggcgagatccggcgatgacaccacaacc 67
Query: 1452 ag 1453
||
Sbjct: 66 ag 65
>gb|CO159587.1|CO159587 FLD1_14_B09.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_14_B09_A029 5', mRNA sequence
Length = 784
Score = 159 bits (80), Expect = 5e-037
Identities = 125/140 (89%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 355 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 296
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgttgcgg 1379
||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||
Sbjct: 295 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgttccga 236
Query: 1380 gtgcgggagccgaactccac 1399
|| || || |||||||||||
Sbjct: 235 gtccgcgacccgaactccac 216
Score = 54.0 bits (27), Expect = 2e-005
Identities = 114/143 (79%)
Strand = Plus / Minus
Query: 1014 tagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagcgccttgagcttg 1073
||||| |||||||||||||| | ||||||||| | ||| | ||||| |||||||| |
Sbjct: 601 tagttatactcgaagctctgggccaggcggctcctctcgccattgagagccttgaggcgg 542
Query: 1074 ttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatgcggaacatgtcg 1133
|||||||||||||| |||||| ||||| || | ||| ||||| || | | ||||| |
Sbjct: 541 aggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatcctgtacatgatg 482
Query: 1134 ttgtacatcatcagctggaggcg 1156
|| ||||||| |||||| |||||
Sbjct: 481 ttatacatcaccagctgcaggcg 459
>gb|BG276034.1|BG276034 NXSI_147_H11_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_147_H11 5' similar to Arabidopsis thaliana
sequence At2g30490 cinnamate-4-hydroxylase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 339
Score = 151 bits (76), Expect = 1e-034
Identities = 106/116 (91%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 128 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 69
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgtt 1375
||||||||||||||||||||||||||||| |||||||| || ||||||||||||||
Sbjct: 68 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgtt 13
>gb|BG319095.1|BG319095 NXPV_023_F10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_023_F10 5' similar to Arabidopsis
thaliana sequence At2g30490 cinnamate-4-hydroxylase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 406
Score = 151 bits (76), Expect = 1e-034
Identities = 106/116 (91%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 131 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 72
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgtt 1375
||||||||||||||||||||||||||||| |||||||| || ||||||||||||||
Sbjct: 71 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgtt 16
>gb|AI812674.1|AI812674 17G2 Pine Lambda Zap Xylem library Pinus taeda cDNA, mRNA sequence
Length = 438
Score = 145 bits (73), Expect = 7e-033
Identities = 130/149 (87%)
Strand = Plus / Minus
Query: 1305 cgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcg 1364
||||| || ||||||||||||||||||||||||||||||||||| |||||||| || |||
Sbjct: 435 cgccaatgctcgccgtacaccgtgaacaccatgtcctgccccttccccgtgaatatatcg 376
Query: 1365 aacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagcacctccttg 1424
||||||||||| || || || || ||||||||||| ||||||||||| || |||||||||
Sbjct: 375 aacaccacgttccgagtccgcgacccgaactccaccccctgcgtgtgcagaacctccttg 316
Query: 1425 gccagctccggggtcgacaccaccaccag 1453
|| || ||||| | |||||||| |||||
Sbjct: 315 gcgagatccggcgatgacaccacaaccag 287
>gb|CF667497.1|CF667497 RTCNT1_30_D11.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_30_D11_A029 5', mRNA sequence
Length = 801
Score = 143 bits (72), Expect = 3e-032
Identities = 105/116 (90%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
||||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 125 accttgttggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 66
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgtt 1375
||||||||||||||||||||||||||||| |||||||| || | ||||||||||||
Sbjct: 65 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatagaacaccacgtt 10
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 383 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 324
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 323 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 264
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 263 ctgtacatgatgttatacatcaccagctgcaggcg 229
Score = 56.0 bits (28), Expect = 5e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 720 gggtggttcaccagctcggcgatgccccactcgatcgaccacagtgtcgtctcgatcgct 779
||||||||||| | ||||||| ||||| || || ||||| | || |||||||| |||
Sbjct: 677 gggtggttcacgatttcggcgagtccccattccatggaccataaagttgtctcgattgct 618
Query: 780 gcgacgttgatgttctcgacgatgtagaggacgttgtcgtggttgatctcgccctt 835
|| || || |||||||| |||||||||||||| ||||| | ||| || ||||||||
Sbjct: 617 gcaacattaatgttctccacgatgtagaggacattgtcttcgtttatttcgccctt 562
>gb|DN456247.1|DN456247 EST952046 Sequencing ESTs from loblolly pine embryos Pinus taeda cDNA
clone RPIGM94 5' end, mRNA sequence
Length = 572
Score = 143 bits (72), Expect = 3e-032
Identities = 105/116 (90%)
Strand = Plus / Minus
Query: 1260 accttgttggtgaagaaggggacggtcatgatgcgccgcatcttgcgccagtggtcgccg 1319
|||||| |||| |||||||| || |||||||| ||||||||||| ||||| || ||||||
Sbjct: 150 accttgatggtaaagaagggcaccgtcatgatccgccgcatcttccgccaatgctcgccg 91
Query: 1320 tacaccgtgaacaccatgtcctgccccttgcccgtgaagatgtcgaacaccacgtt 1375
||||||||||||||||||||||||||||| |||||||| || ||||||||||||||
Sbjct: 90 tacaccgtgaacaccatgtcctgccccttccccgtgaatatatcgaacaccacgtt 35
Score = 61.9 bits (31), Expect = 8e-008
Identities = 124/155 (80%)
Strand = Plus / Minus
Query: 1002 atgaagtcgccgtagttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagc 1061
|||||||| || ||||| |||||||||||||| | ||||||||| | ||| | |||||
Sbjct: 408 atgaagtcaccatagttatactcgaagctctgggccaggcggctcctctcgccattgaga 349
Query: 1062 gccttgagcttgttgaagagcgggtcgtgctcgctgtcgaaccggcggtcgaacatgatg 1121
|||||||| | |||||||||||||| |||||| ||||| || | ||| ||||| ||
Sbjct: 348 gccttgaggcggaggaagagcgggtcgtcctcgctctcgaagcgcctgtcaaacatcatc 289
Query: 1122 cggaacatgtcgttgtacatcatcagctggaggcg 1156
| | ||||| ||| ||||||| |||||| |||||
Sbjct: 288 ctgtacatgatgttatacatcaccagctgcaggcg 254
>gb|BX254757.1|BX254757 BX254757 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP103H08 similar to TRANS CINNAMATE 4
MONOOXYGENASE, mRNA sequence
Length = 659
Score = 139 bits (70), Expect = 4e-031
Identities = 118/134 (88%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || |||||||||||||||||||||||||| |||
Sbjct: 466 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgccggtg 407
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || ||||||||||||||||| ||||| ||
Sbjct: 406 aagatatcgaacaccacgttccgggttcgagacccgaactccacgccctgggtgtgcagg 347
Query: 1416 acctccttggccag 1429
||||||||||||||
Sbjct: 346 acctccttggccag 333
>gb|BX254922.1|BX254922 BX254922 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP107E04 similar to TRANS CINNAMATE 4
MONOOXYGENASE, mRNA sequence
Length = 537
Score = 139 bits (70), Expect = 4e-031
Identities = 118/134 (88%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || |||||||||||||||||||||||||| |||
Sbjct: 464 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgccggtg 405
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || ||||||||||||||||| ||||| ||
Sbjct: 404 aagatatcgaacaccacgttccgggttcgagacccgaactccacgccctgggtgtgcagg 345
Query: 1416 acctccttggccag 1429
||||||||||||||
Sbjct: 344 acctccttggccag 331
>gb|BE761856.1|BE761856 NXCI_070_F06_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_070_F06 5' similar to Arabidopsis
thaliana sequence At2g30490 cinnamate-4-hydroxylase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 438
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 320 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 261
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 260 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 201
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 200 acctccttggc 190
>gb|BE762259.1|BE762259 NXCI_067_C10_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_067_C10 5' similar to Arabidopsis
thaliana sequence At2g30490 cinnamate-4-hydroxylase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 361
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 162 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 103
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 102 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 43
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 42 acctccttggc 32
>gb|BE762275.1|BE762275 NXCI_067_E07_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_067_E07 5' similar to Arabidopsis
thaliana sequence At2g30490 cinnamate-4-hydroxylase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 381
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 162 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 103
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 102 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 43
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 42 acctccttggc 32
>gb|BF186455.1|BF186455 NXCI_137_F12_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_137_F12 5' similar to Arabidopsis
thaliana sequence At2g30490 cinnamate-4-hydroxylase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 368
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 287 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 228
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 227 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 168
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 167 acctccttggc 157
>gb|BF517288.1|BF517288 NXSI_012_F04_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_012_F04 5' similar to Arabidopsis thaliana
sequence At2g30490 cinnamate-4-hydroxylase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 497
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 415 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 356
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 355 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 296
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 295 acctccttggc 285
>gb|CF385486.1|CF385486 RTDR1_4_A06.b1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_4_A06_A015 3', mRNA sequence
Length = 615
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Plus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 167 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 226
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 227 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 286
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 287 acctccttggc 297
>gb|CF670152.1|CF670152 RTCNT1_48_A01.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_48_A01_A029 5', mRNA sequence
Length = 567
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 347 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 288
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 287 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 228
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 227 acctccttggc 217
>gb|CO367943.1|CO367943 RTK1_37_D12.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_37_D12_A029 5', mRNA sequence
Length = 737
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 421 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 362
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 361 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 302
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 301 acctccttggc 291
Score = 44.1 bits (22), Expect = 0.019
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 1017 ttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagcgccttgagcttgttg 1076
|||||||| |||||||| | || || || ||||| ||||||| |||||||||||| |
Sbjct: 700 ttgtactcaaagctctgggccaatcgacttcgctctccgttgagggccttgagcttgagg 641
Query: 1077 aagagcgggtcgtgctcg 1094
|| |||||||||| ||||
Sbjct: 640 aaaagcgggtcgtcctcg 623
>gb|CV035647.1|CV035647 RTNACL1_41_B03.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_41_B03_A029 5', mRNA sequence
Length = 705
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 377 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 318
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 317 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 258
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 257 acctccttggc 247
Score = 44.1 bits (22), Expect = 0.019
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 1017 ttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagcgccttgagcttgttg 1076
|||||||| |||||||| | || || || ||||| ||||||| |||||||||||| |
Sbjct: 656 ttgtactcaaagctctgggccaatcgacttcgctctccgttgagggccttgagcttgagg 597
Query: 1077 aagagcgggtcgtgctcg 1094
|| |||||||||| ||||
Sbjct: 596 aaaagcgggtcgtcctcg 579
>gb|CV035656.1|CV035656 RTNACL1_41_C03.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_41_C03_A029 5', mRNA sequence
Length = 800
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 383 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 324
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 323 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 264
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 263 acctccttggc 253
Score = 44.1 bits (22), Expect = 0.019
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 1017 ttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagcgccttgagcttgttg 1076
|||||||| |||||||| | || || || ||||| ||||||| |||||||||||| |
Sbjct: 662 ttgtactcaaagctctgggccaatcgacttcgctctccgttgagggccttgagcttgagg 603
Query: 1077 aagagcgggtcgtgctcg 1094
|| |||||||||| ||||
Sbjct: 602 aaaagcgggtcgtcctcg 585
>gb|CX648414.1|CX648414 COLD1_28_B08.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_28_B08_A029 5', mRNA sequence
Length = 749
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 432 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 373
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 372 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 313
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 312 acctccttggc 302
Score = 44.1 bits (22), Expect = 0.019
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 1017 ttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagcgccttgagcttgttg 1076
|||||||| |||||||| | || || || ||||| ||||||| |||||||||||| |
Sbjct: 711 ttgtactcaaagctctgggccaatcgacttcgctctccgttgagggccttgagcttgagg 652
Query: 1077 aagagcgggtcgtgctcg 1094
|| |||||||||| ||||
Sbjct: 651 aaaagcgggtcgtcctcg 634
>gb|DR069698.1|DR069698 RTDK1_8_H09.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_8_H09_A029 5', mRNA sequence
Length = 789
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 159 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 100
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 99 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 40
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 39 acctccttggc 29
Score = 81.8 bits (41), Expect = 9e-014
Identities = 74/85 (87%)
Strand = Plus / Minus
Query: 721 ggtggttcaccagctcggcgatgccccactcgatcgaccacagtgtcgtctcgatcgctg 780
|||||||||||||||| || || ||||| || ||||||||||| || ||||| || ||||
Sbjct: 749 ggtggttcaccagctccgctattccccattccatcgaccacagcgttgtctcaattgctg 690
Query: 781 cgacgttgatgttctcgacgatgta 805
| |||||||||||||| ||||||||
Sbjct: 689 caacgttgatgttctcaacgatgta 665
Score = 44.1 bits (22), Expect = 0.019
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 1017 ttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagcgccttgagcttgttg 1076
|||||||| |||||||| | || || || ||||| ||||||| |||||||||||| |
Sbjct: 438 ttgtactcaaagctctgggccaatcgacttcgctctccgttgagggccttgagcttgagg 379
Query: 1077 aagagcgggtcgtgctcg 1094
|| |||||||||| ||||
Sbjct: 378 aaaagcgggtcgtcctcg 361
>gb|DR069823.1|DR069823 RTDK1_9_D10.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_9_D10_A029 5', mRNA sequence
Length = 648
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 419 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 360
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 359 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 300
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 299 acctccttggc 289
>gb|DR081652.1|DR081652 RTFEPL1_31_E09.b1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_31_E09_A029 3', mRNA sequence
Length = 652
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Plus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 272 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 331
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 332 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 391
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 392 acctccttggc 402
Score = 42.1 bits (21), Expect = 0.073
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 1054 cgttgagcgccttgagcttgttgaagagcgggtcgtgctcg 1094
||||||| |||||||||||| ||| |||||||||| ||||
Sbjct: 30 cgttgagggccttgagcttgaggaaaagcgggtcgtcctcg 70
>gb|DR099065.1|DR099065 STRR1_52_H11.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_52_H11_A033 3', mRNA sequence
Length = 751
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Plus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 315 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 374
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 375 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 434
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 435 acctccttggc 445
Score = 42.1 bits (21), Expect = 0.073
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 1054 cgttgagcgccttgagcttgttgaagagcgggtcgtgctcg 1094
||||||| |||||||||||| ||| |||||||||| ||||
Sbjct: 73 cgttgagggccttgagcttgaggaaaagcgggtcgtcctcg 113
>gb|DR385406.1|DR385406 RTHG1_8_A11.g1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_8_A11_A029 5', mRNA sequence
Length = 675
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 447 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 388
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 387 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 328
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 327 acctccttggc 317
>gb|AH014354.1|SEG_AY764801S Pinus taeda isolate 16 cinnamate 4-hydroxylase gene, exons 1 through
3 and partial cds
Length = 2493
Score = 133 bits (67), Expect = 3e-029
Identities = 115/131 (87%)
Strand = Plus / Minus
Query: 1296 cgcatcttgcgccagtggtcgccgtacaccgtgaacaccatgtcctgccccttgcccgtg 1355
|||||||| | |||||| || || || || ||||||||||||||||||||||||||||||
Sbjct: 415 cgcatctttctccagtgatctccatagacggtgaacaccatgtcctgccccttgcccgtg 356
Query: 1356 aagatgtcgaacaccacgttgcgggtgcgggagccgaactccacgccctgcgtgtggagc 1415
||||| |||||||||||||| ||||| || || |||||||| |||||||| ||||| ||
Sbjct: 355 aagatatcgaacaccacgttccgggttcgagacccgaactcgacgccctgggtgtgcagg 296
Query: 1416 acctccttggc 1426
|||||||||||
Sbjct: 295 acctccttggc 285
Score = 75.8 bits (38), Expect = 5e-012
Identities = 116/142 (81%)
Strand = Plus / Minus
Query: 493 accaggcattgacgaggatcttggactcggcggggatgtcgtagccggcgagcttgccgt 552
||||||| || || ||||||||| ||| || || || |||||||| |||||||| |||
Sbjct: 2153 accaggcgttcaccaggatcttgctctctgccggaatatcgtagcccccgagcttggcgt 2094
Query: 553 cgttgaggttcatgtgggggaccagcagcgggatggccatgcgcaggcggagcgtctcct 612
||| ||| |||||||||||||| |||| |||||| |||||||| || || || || ||||
Sbjct: 2093 cgtggagattcatgtgggggacgagcaacgggatcgccatgcggagacgaagggtttcct 2034
Query: 613 tgacgatggcctgaaggtaggg 634
| || | ||||||||||||||
Sbjct: 2033 tcacaaccgcctgaaggtaggg 2012
Score = 50.1 bits (25), Expect = 3e-004
Identities = 52/61 (85%)
Strand = Plus / Minus
Query: 721 ggtggttcaccagctcggcgatgccccactcgatcgaccacagtgtcgtctcgatcgctg 780
|||||||||||||||| || || ||||| || ||||||||||| || ||||| || ||||
Sbjct: 1925 ggtggttcaccagctccgctattccccattccatcgaccacagcgttgtctcaattgctg 1866
Query: 781 c 781
|
Sbjct: 1865 c 1865
Score = 44.1 bits (22), Expect = 0.019
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 1017 ttgtactcgaagctctgcgacaggcggctgcgctccgcgttgagcgccttgagcttgttg 1076
|||||||| |||||||| | || || || ||||| ||||||| |||||||||||| |
Sbjct: 652 ttgtactcaaagctctgggccaatcgacttcgctctccgttgagggccttgagcttgagg 593
Query: 1077 aagagcgggtcgtgctcg 1094
|| |||||||||| ||||
Sbjct: 592 aaaagcgggtcgtcctcg 575
Score = 40.1 bits (20), Expect = 0.29
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 778 ctgcgacgttgatgttctcgacgatgta 805
|||| |||||||||||||| ||||||||
Sbjct: 1303 ctgcaacgttgatgttctcaacgatgta 1276
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 178,937
Number of Sequences: 355925
Number of extensions: 178937
Number of successful extensions: 53704
Number of sequences better than 0.5: 532
Number of HSP's better than 0.5 without gapping: 500
Number of HSP's successfully gapped in prelim test: 32
Number of HSP's that attempted gapping in prelim test: 51795
Number of HSP's gapped (non-prelim): 1784
length of query: 1689
length of database: 217,277,237
effective HSP length: 20
effective length of query: 1669
effective length of database: 210,158,737
effective search space: 350754932053
effective search space used: 350754932053
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)