BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2493944.2.2
(2027 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DR014430.1|DR014430 HEAT1_49_A07.g1_A029 Root at 37 C fo... 68 2e-009
gb|DR102156.1|DR102156 STRR1_78_H02.g1_A033 Stem Response R... 48 0.001
gb|DR690351.1|DR690351 EST1080437 Normalized pine embryo li... 44 0.022
gb|DT636133.1|DT636133 EST1151064 Normalized pine embryo li... 44 0.022
>gb|DR014430.1|DR014430 HEAT1_49_A07.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_49_A07_A029 5', mRNA sequence
Length = 914
Score = 67.9 bits (34), Expect = 2e-009
Identities = 55/62 (88%)
Strand = Plus / Plus
Query: 223 aagaactggatcaatgatcccaacgcgcccatgtactacaaggggtggtaccatttcttc 282
||||||||||| |||||||| || |||||||||| ||||||||| | ||||||||||||
Sbjct: 67 aagaactggatgaatgatccaaatgcgcccatgttctacaagggatactaccatttcttc 126
Query: 283 ta 284
||
Sbjct: 127 ta 128
>gb|DR102156.1|DR102156 STRR1_78_H02.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_78_H02_A033 5', mRNA sequence
Length = 603
Score = 48.1 bits (24), Expect = 0.001
Identities = 60/72 (83%)
Strand = Plus / Plus
Query: 229 tggatcaatgatcccaacgcgcccatgtactacaaggggtggtaccatttcttctaccaa 288
||||| ||||||||||| ||||| | | ||||||||| | || ||||| |||||||||
Sbjct: 170 tggatgaatgatcccaatgcgccattattctacaagggctactatcatttgttctaccaa 229
Query: 289 tacaatcccaag 300
|| |||||||||
Sbjct: 230 tataatcccaag 241
>gb|DR690351.1|DR690351 EST1080437 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWACU06 3' end, mRNA sequence
Length = 908
Score = 44.1 bits (22), Expect = 0.022
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 781 atgtgggagtgccccgacttctacccggtg 810
|||||||||||||| || ||||||||||||
Sbjct: 23 atgtgggagtgcccggatttctacccggtg 52
>gb|DT636133.1|DT636133 EST1151064 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMGO37 3' end, mRNA sequence
Length = 870
Score = 44.1 bits (22), Expect = 0.022
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 781 atgtgggagtgccccgacttctacccggtg 810
|||||||||||||| || ||||||||||||
Sbjct: 31 atgtgggagtgcccggatttctacccggtg 60
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 168,514
Number of Sequences: 355925
Number of extensions: 168514
Number of successful extensions: 50520
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50511
Number of HSP's gapped (non-prelim): 9
length of query: 2027
length of database: 217,277,237
effective HSP length: 20
effective length of query: 2007
effective length of database: 210,158,737
effective search space: 421788585159
effective search space used: 421788585159
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)