BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2448387.2.1
(919 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
dbj|BD224542.1| Materials and methods for the modification ... 76 3e-012
gb|DR116749.1|DR116749 RTMG1_2_C01.g1_A029 Roots minus magn... 72 4e-011
gb|BX253310.1|BX253310 BX253310 Pinus pinaster differenciat... 64 1e-008
gb|BF169470.1|BF169470 NXCI_123_A06_F NXCI (Nsf Xylem Compr... 64 1e-008
gb|BF518234.1|BF518234 NXSI_036_F06_F NXSI (Nsf Xylem Side ... 64 1e-008
gb|BQ702305.1|BQ702305 NXSI_127_C04_F NXSI (Nsf Xylem Side ... 64 1e-008
gb|CF385606.1|CF385606 RTDR1_5_D06.b1_A015 Loblolly pine ro... 64 1e-008
gb|CF393502.1|CF393502 RTDR3_13_D03.g1_A022 Loblolly pine r... 64 1e-008
gb|CF399865.1|CF399865 RTWW1_1_F04.g1_A015 Well-watered lob... 64 1e-008
gb|CF401996.1|CF401996 RTWW1_16_D03.g1_A015 Well-watered lo... 64 1e-008
gb|CF402273.1|CF402273 RTWW1_19_G06.g1_A015 Well-watered lo... 64 1e-008
gb|CF671298.1|CF671298 RTCNT1_56_D06.b1_A029 Root control P... 64 1e-008
gb|BX784216.1|BX784216 BX784216 Pinus pinaster differenciat... 64 1e-008
gb|CO166419.1|CO166419 FLD1_61_H04.g1_A029 Root flooded Pin... 64 1e-008
gb|CO201630.1|CO201630 RTCNT2_7_C08.b1_A029 Root control 2 ... 64 1e-008
gb|CO201703.1|CO201703 RTCNT2_7_C08.g1_A029 Root control 2 ... 64 1e-008
gb|CO362045.1|CO362045 NDL2_8_G01.g1_A029 Needles control 2... 64 1e-008
gb|CV032697.1|CV032697 RTNACL1_17_F12.g1_A029 Roots plus ad... 64 1e-008
gb|CX714585.1|CX714585 RTPQ1_23_E02.g1_A032 Roots treated w... 64 1e-008
gb|DR019194.1|DR019194 STRS1_28_H10.b2_A034 Shoot tip pitch... 64 1e-008
gb|DR019282.1|DR019282 STRS1_28_H10.g1_A034 Shoot tip pitch... 64 1e-008
gb|DR049100.1|DR049100 RTBOR1_13_H01.b1_A029 Roots plus add... 64 1e-008
gb|DR055128.1|DR055128 RTCA1_21_E12.g2_A029 Roots minus cal... 64 1e-008
gb|DR069800.1|DR069800 RTDK1_9_B09.g1_A029 Roots, dark Pinu... 64 1e-008
gb|DR071752.1|DR071752 RTDK1_21_H05.g1_A029 Roots, dark Pin... 64 1e-008
gb|DR092921.1|DR092921 STRR1_5_A01.b1_A033 Stem Response Re... 64 1e-008
gb|DR092999.1|DR092999 STRR1_5_A01.g1_A033 Stem Response Re... 64 1e-008
gb|DR096367.1|DR096367 STRR1_27_C01.g1_A033 Stem Response R... 64 1e-008
gb|DR100567.1|DR100567 STRR1_65_D03.b1_A033 Stem Response R... 64 1e-008
gb|DR101893.1|DR101893 STRR1_76_C02.g1_A033 Stem Response R... 64 1e-008
gb|DR101975.1|DR101975 STRR1_77_E04.b1_A033 Stem Response R... 64 1e-008
gb|DR116726.1|DR116726 RTMG1_2_A01.g1_A029 Roots minus magn... 64 1e-008
gb|DR744549.1|DR744549 RTCU1_23_E12.b1_A029 Roots plus adde... 64 1e-008
gb|DR744616.1|DR744616 RTCU1_23_E12.g1_A029 Roots plus adde... 64 1e-008
dbj|BD224332.1| Materials and methods for the modification ... 64 1e-008
dbj|BD224366.1| Materials and methods for the modification ... 64 1e-008
dbj|BD272988.1| Materials and methods for the modification ... 64 1e-008
gb|AI812407.1|AI812407 10A6 Pine Lambda Zap Xylem library P... 56 3e-006
gb|AW290167.1|AW290167 NXNV015G05F Nsf Xylem Normal wood Ve... 56 3e-006
gb|AL751078.1|AL751078 AL751078 RS Pinus pinaster cDNA clon... 56 3e-006
gb|BF010576.1|BF010576 NXCI_086_C09_F NXCI (Nsf Xylem Compr... 56 3e-006
gb|BG526919.1|BG526919 NXPV_057_D07_F NXPV (Nsf Xylem Plani... 56 3e-006
gb|BI077306.1|BI077306 NXPV_095_D09_F NXPV (Nsf Xylem Plani... 56 3e-006
gb|BQ702559.1|BQ702559 NXSI_130_A02_F NXSI (Nsf Xylem Side ... 56 3e-006
gb|CD026879.1|CD026879 NXNV015G05 Nsf Xylem Normal wood Ver... 56 3e-006
gb|BX679891.1|BX679891 BX679891 RS Pinus pinaster cDNA clon... 56 3e-006
gb|CO159104.1|CO159104 FLD1_11_H06.b1_A029 Root flooded Pin... 56 3e-006
gb|CO159169.1|CO159169 FLD1_11_H06.g1_A029 Root flooded Pin... 56 3e-006
gb|CO163929.1|CO163929 FLD1_44_E06.g1_A029 Root flooded Pin... 56 3e-006
gb|CO200758.1|CO200758 RTCNT2_1_G11.b1_A029 Root control 2 ... 56 3e-006
gb|CO200836.1|CO200836 RTCNT2_1_G11.g1_A029 Root control 2 ... 56 3e-006
gb|DR018039.1|DR018039 STRS1_20_D02.b1_A034 Shoot tip pitch... 56 3e-006
gb|DR386037.1|DR386037 RTHG1_12_B08.g1_A029 Roots plus adde... 56 3e-006
gb|DR743998.1|DR743998 RTCU1_19_C05.g1_A029 Roots plus adde... 56 3e-006
gb|U12013.1|PTU12013 Pinus taeda PT4CL2 4-coumarate-CoA lig... 56 3e-006
dbj|BD224288.1| Materials and methods for the modification ... 56 3e-006
dbj|BD224375.1| Materials and methods for the modification ... 56 3e-006
gb|AH014198.1|SEG_AY764393S Pinus taeda isolate 22 4-coumar... 56 3e-006
gb|AY764394.1|AY764393S2 Pinus taeda isolate 22 4-coumarate... 56 3e-006
gb|AH014199.1|SEG_AY764396S Pinus taeda isolate 10 4-coumar... 56 3e-006
gb|AY764397.1|AY764396S2 Pinus taeda isolate 10 4-coumarate... 56 3e-006
gb|AH014200.1|SEG_AY764399S Pinus taeda isolate 24 4-coumar... 56 3e-006
gb|AY764400.1|AY764399S2 Pinus taeda isolate 24 4-coumarate... 56 3e-006
gb|AH014201.1|SEG_AY764402S Pinus taeda isolate 15 4-coumar... 56 3e-006
gb|AY764403.1|AY764402S2 Pinus taeda isolate 15 4-coumarate... 56 3e-006
gb|AH014202.1|SEG_AY764405S Pinus taeda isolate 17 4-coumar... 56 3e-006
gb|AY764406.1|AY764405S2 Pinus taeda isolate 17 4-coumarate... 56 3e-006
gb|AH014203.1|SEG_AY764408S Pinus taeda isolate 23 4-coumar... 56 3e-006
gb|AY764409.1|AY764408S2 Pinus taeda isolate 23 4-coumarate... 56 3e-006
gb|AH014204.1|SEG_AY764411S Pinus taeda isolate 16 4-coumar... 56 3e-006
gb|AY764412.1|AY764411S2 Pinus taeda isolate 16 4-coumarate... 56 3e-006
gb|AH014205.1|SEG_AY764414S Pinus taeda isolate 30 4-coumar... 56 3e-006
gb|AY764415.1|AY764414S2 Pinus taeda isolate 30 4-coumarate... 56 3e-006
gb|AH014206.1|SEG_AY764417S Pinus taeda isolate 13 4-coumar... 56 3e-006
gb|AY764418.1|AY764417S2 Pinus taeda isolate 13 4-coumarate... 56 3e-006
gb|AH014208.1|SEG_AY764423S Pinus taeda isolate 7 4-coumara... 56 3e-006
gb|AY764424.1|AY764423S2 Pinus taeda isolate 7 4-coumarate:... 56 3e-006
gb|AH014209.1|SEG_AY764426S Pinus taeda isolate 31 4-coumar... 56 3e-006
gb|AY764427.1|AY764426S2 Pinus taeda isolate 31 4-coumarate... 56 3e-006
gb|AH014211.1|SEG_AY764432S Pinus taeda isolate 25 4-coumar... 56 3e-006
gb|AY764433.1|AY764432S2 Pinus taeda isolate 25 4-coumarate... 56 3e-006
gb|AH014213.1|SEG_AY764438S Pinus taeda isolate 27 4-coumar... 56 3e-006
gb|AY764439.1|AY764438S2 Pinus taeda isolate 27 4-coumarate... 56 3e-006
gb|AH014214.1|SEG_AY764441S Pinus taeda isolate 8 4-coumara... 56 3e-006
gb|AY764442.1|AY764441S2 Pinus taeda isolate 8 4-coumarate:... 56 3e-006
gb|AH014215.1|SEG_AY764444S Pinus taeda isolate 26 4-coumar... 56 3e-006
gb|AY764445.1|AY764444S2 Pinus taeda isolate 26 4-coumarate... 56 3e-006
gb|AH014216.1|SEG_AY764447S Pinus taeda isolate 5 4-coumara... 56 3e-006
gb|AY764448.1|AY764447S2 Pinus taeda isolate 5 4-coumarate:... 56 3e-006
gb|AH014218.1|SEG_AY764453S Pinus taeda isolate 4 4-coumara... 56 3e-006
gb|AY764454.1|AY764453S2 Pinus taeda isolate 4 4-coumarate:... 56 3e-006
gb|AH014221.1|SEG_AY764462S Pinus taeda isolate 1 4-coumara... 56 3e-006
gb|AY764463.1|AY764462S2 Pinus taeda isolate 1 4-coumarate:... 56 3e-006
gb|AH014222.1|SEG_AY764465S Pinus taeda isolate 19 4-coumar... 56 3e-006
gb|AY764466.1|AY764465S2 Pinus taeda isolate 19 4-coumarate... 56 3e-006
gb|AH014223.1|SEG_AY764468S Pinus taeda isolate 29 4-coumar... 56 3e-006
gb|AY764469.1|AY764468S2 Pinus taeda isolate 29 4-coumarate... 56 3e-006
gb|AH014224.1|SEG_AY764471S Pinus taeda isolate 18 4-coumar... 56 3e-006
gb|AY764472.1|AY764471S2 Pinus taeda isolate 18 4-coumarate... 56 3e-006
gb|AH014225.1|SEG_AY764474S Pinus taeda isolate 20 4-coumar... 56 3e-006
gb|AY764475.1|AY764474S2 Pinus taeda isolate 20 4-coumarate... 56 3e-006
gb|AH014227.1|SEG_AY764480S Pinus taeda isolate 12 4-coumar... 56 3e-006
gb|AY764481.1|AY764480S2 Pinus taeda isolate 12 4-coumarate... 56 3e-006
gb|AH014228.1|SEG_AY764483S Pinus taeda isolate 2 4-coumara... 56 3e-006
gb|AY764484.1|AY764483S2 Pinus taeda isolate 2 4-coumarate:... 56 3e-006
gb|AH014229.1|SEG_AY764486S Pinus taeda isolate 14 4-coumar... 56 3e-006
gb|AY764487.1|AY764486S2 Pinus taeda isolate 14 4-coumarate... 56 3e-006
gb|AW754726.1|AW754726 PC07B01 Pine TriplEx pollen cone lib... 54 1e-005
gb|DR116666.1|DR116666 RTMG1_2_C01.b1_A029 Roots minus magn... 54 1e-005
gb|BE761948.1|BE761948 NXCI_075_B08_F NXCI (Nsf Xylem Compr... 50 2e-004
gb|AW289536.1|AW289536 NXNV002B02F Nsf Xylem Normal wood Ve... 48 6e-004
gb|AW985299.1|AW985299 NXNV_135_E09_F Nsf Xylem Normal wood... 48 6e-004
gb|CD028108.1|CD028108 NXNV002B02 Nsf Xylem Normal wood Ver... 48 6e-004
gb|CF398551.1|CF398551 RTDS3_15_H06.g1_A022 Drought-stresse... 48 6e-004
gb|U12012.1|PTU12012 Pinus taeda PT4CL1 4-coumarate-CoA lig... 48 6e-004
gb|U39404.1|PTU39404 Pinus taeda xylem 4-coumarate:CoA liga... 48 6e-004
gb|U39405.1|PTU39405 Pinus taeda xylem 4-coumarate:CoA liga... 48 6e-004
gb|AH014207.1|SEG_AY764420S Pinus taeda isolate 28 4-coumar... 48 6e-004
gb|AY764421.1|AY764420S2 Pinus taeda isolate 28 4-coumarate... 48 6e-004
gb|AH014210.1|SEG_AY764429S Pinus taeda isolate 32 4-coumar... 48 6e-004
gb|AY764430.1|AY764429S2 Pinus taeda isolate 32 4-coumarate... 48 6e-004
gb|AH014212.1|SEG_AY764435S Pinus taeda isolate 11 4-coumar... 48 6e-004
gb|AY764436.1|AY764435S2 Pinus taeda isolate 11 4-coumarate... 48 6e-004
gb|AH014217.1|SEG_AY764450S Pinus taeda isolate 3 4-coumara... 48 6e-004
gb|AY764451.1|AY764450S2 Pinus taeda isolate 3 4-coumarate:... 48 6e-004
gb|AH014219.1|SEG_AY764456S Pinus taeda isolate 6 4-coumara... 48 6e-004
gb|AY764457.1|AY764456S2 Pinus taeda isolate 6 4-coumarate:... 48 6e-004
gb|AH014220.1|SEG_AY764459S Pinus taeda isolate 9 4-coumara... 48 6e-004
gb|AY764460.1|AY764459S2 Pinus taeda isolate 9 4-coumarate:... 48 6e-004
gb|AH014226.1|SEG_AY764477S Pinus taeda isolate 21 4-coumar... 48 6e-004
gb|AY764478.1|AY764477S2 Pinus taeda isolate 21 4-coumarate... 48 6e-004
gb|BX251844.1|BX251844 BX251844 Pinus pinaster differenciat... 44 0.010
gb|BG317657.1|BG317657 NXPV_004_C07_F NXPV (Nsf Xylem Plani... 44 0.010
gb|BI643841.1|BI643841 NXPV_123_F05_F NXPV (Nsf Xylem Plani... 44 0.010
gb|BQ698042.1|BQ698042 NXPV_063_H04_F NXPV (Nsf Xylem Plani... 44 0.010
gb|CF390990.1|CF390990 RTDR3_3_G03.b1_A022 Loblolly pine ro... 44 0.010
gb|CF401087.1|CF401087 RTWW1_10_F02.b1_A015 Well-watered lo... 44 0.010
gb|CF669432.1|CF669432 RTCNT1_43_G10.b1_A029 Root control P... 44 0.010
gb|CF671894.1|CF671894 RTCNT1_60_A12.b1_A029 Root control P... 44 0.010
gb|DR102397.1|DR102397 STRR1_80_G02.g1_A033 Stem Response R... 44 0.010
gb|DR101831.1|DR101831 STRR1_76_D10.b1_A033 Stem Response R... 40 0.16
gb|DR101909.1|DR101909 STRR1_76_D10.g1_A033 Stem Response R... 40 0.16
>dbj|BD224542.1| Materials and methods for the modification of plant lignin content
Length = 2043
Score = 75.8 bits (38), Expect = 3e-012
Identities = 101/122 (82%)
Strand = Plus / Minus
Query: 680 gcctccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcgg 739
||||| |||||||| || || |||||||||||||||||||||||||| ||||| | ||
Sbjct: 1449 gcctctagctcggccggagcaacctggaagcccttgtacttgatgagttccttcaaccga 1390
Query: 740 tccacgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagccac 799
|| || ||||| | ||| |||| ||||| ||||| |||| |||||| ||||| ||||||
Sbjct: 1389 tcgacaatgaagagctcgtcgtcatcgtctatgtagccgatgtcgccggtgtgcagccac 1330
Query: 800 cc 801
||
Sbjct: 1329 cc 1328
>gb|DR116749.1|DR116749 RTMG1_2_C01.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_2_C01_A029 5', mRNA sequence
Length = 384
Score = 71.9 bits (36), Expect = 4e-011
Identities = 96/116 (82%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | |||||
Sbjct: 346 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactcggtcg 287
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 286 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 231
>gb|BX253310.1|BX253310 BX253310 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP081A07 similar to 4 coumarate CoA ligase,
mRNA sequence
Length = 680
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 216 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 157
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 156 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 101
>gb|BF169470.1|BF169470 NXCI_123_A06_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_123_A06 5' similar to Arabidopsis
thaliana sequence At3g21240 putative 4-coumarate:CoA
ligase 2 see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 512
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 295 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 236
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 235 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 180
>gb|BF518234.1|BF518234 NXSI_036_F06_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_036_F06 5' similar to Arabidopsis thaliana
sequence At3g21240 putative 4-coumarate:CoA ligase 2 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 512
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 334 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 275
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 274 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 219
>gb|BQ702305.1|BQ702305 NXSI_127_C04_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_127_C04 5' similar to Arabidopsis thaliana
sequence At3g21240 putative 4-coumarate:CoA ligase 2 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 453
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 437 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 378
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 377 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 322
>gb|CF385606.1|CF385606 RTDR1_5_D06.b1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_5_D06_A015 3', mRNA
sequence
Length = 643
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 176 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 117
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 116 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 61
>gb|CF393502.1|CF393502 RTDR3_13_D03.g1_A022 Loblolly pine roots recovering from drought
DR3 Pinus taeda cDNA clone RTDR3_13_D03_A022 5', mRNA
sequence
Length = 637
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 520 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 461
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 460 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 405
>gb|CF399865.1|CF399865 RTWW1_1_F04.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_1_F04_A015 5', mRNA sequence
Length = 728
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 347 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 288
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 287 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 232
>gb|CF401996.1|CF401996 RTWW1_16_D03.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_16_D03_A015 5', mRNA sequence
Length = 718
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 254 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 195
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 194 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 139
>gb|CF402273.1|CF402273 RTWW1_19_G06.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_19_G06_A015 5', mRNA sequence
Length = 738
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 400 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 341
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 340 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 285
>gb|CF671298.1|CF671298 RTCNT1_56_D06.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_56_D06_A029 3', mRNA sequence
Length = 646
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 179 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 120
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 119 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 64
>gb|BX784216.1|BX784216 BX784216 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 130G11 similar to 4-coumarate--CoA ligase (EC
6.2.1.12), mRNA sequence
Length = 707
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 290 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 231
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 230 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 175
>gb|CO166419.1|CO166419 FLD1_61_H04.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_61_H04_A029 5', mRNA sequence
Length = 843
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 467 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 408
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 407 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 352
>gb|CO201630.1|CO201630 RTCNT2_7_C08.b1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_7_C08_A029 3', mRNA sequence
Length = 852
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 361 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 302
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 301 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 246
>gb|CO201703.1|CO201703 RTCNT2_7_C08.g1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_7_C08_A029 5', mRNA sequence
Length = 845
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 441 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 382
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 381 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 326
>gb|CO362045.1|CO362045 NDL2_8_G01.g1_A029 Needles control 2 Pinus taeda cDNA clone
NDL2_8_G01_A029 5', mRNA sequence
Length = 749
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Plus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 473 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 532
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 533 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 588
>gb|CV032697.1|CV032697 RTNACL1_17_F12.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_17_F12_A029 5', mRNA sequence
Length = 733
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Plus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 465 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 524
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 525 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 580
>gb|CX714585.1|CX714585 RTPQ1_23_E02.g1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_23_E02_A032 5', mRNA sequence
Length = 523
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 383 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 324
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 323 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 268
>gb|DR019194.1|DR019194 STRS1_28_H10.b2_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_28_H10_A034 3', mRNA sequence
Length = 836
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 371 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 312
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 311 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 256
>gb|DR019282.1|DR019282 STRS1_28_H10.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_28_H10_A034 5', mRNA sequence
Length = 791
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 557 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 498
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 497 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 442
>gb|DR049100.1|DR049100 RTBOR1_13_H01.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_13_H01_A029 3', mRNA sequence
Length = 608
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 117 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 58
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 57 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 2
>gb|DR055128.1|DR055128 RTCA1_21_E12.g2_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_21_E12_A029 5', mRNA sequence
Length = 625
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 411 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 352
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 351 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 296
>gb|DR069800.1|DR069800 RTDK1_9_B09.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_9_B09_A029 5', mRNA sequence
Length = 854
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 359 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 300
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 299 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 244
>gb|DR071752.1|DR071752 RTDK1_21_H05.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_21_H05_A029 5', mRNA sequence
Length = 679
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 477 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 418
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 417 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 362
>gb|DR092921.1|DR092921 STRR1_5_A01.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_5_A01_A033 3', mRNA sequence
Length = 858
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 399 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 340
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 339 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 284
>gb|DR092999.1|DR092999 STRR1_5_A01.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_5_A01_A033 5', mRNA sequence
Length = 920
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 518 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 459
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 458 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 403
>gb|DR096367.1|DR096367 STRR1_27_C01.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_27_C01_A033 5', mRNA sequence
Length = 600
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Plus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 417 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 476
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 477 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 532
>gb|DR100567.1|DR100567 STRR1_65_D03.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_65_D03_A033 3', mRNA sequence
Length = 653
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 184 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 125
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 124 actatgaaaatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 69
>gb|DR101893.1|DR101893 STRR1_76_C02.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_76_C02_A033 5', mRNA sequence
Length = 664
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Plus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 398 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 457
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 458 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 513
>gb|DR101975.1|DR101975 STRR1_77_E04.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_77_E04_A033 3', mRNA sequence
Length = 784
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 315 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 256
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 255 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 200
>gb|DR116726.1|DR116726 RTMG1_2_A01.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_2_A01_A029 5', mRNA sequence
Length = 753
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 375 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 316
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 315 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 260
>gb|DR744549.1|DR744549 RTCU1_23_E12.b1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_23_E12_A029 3', mRNA sequence
Length = 799
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 409 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 350
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 349 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 294
>gb|DR744616.1|DR744616 RTCU1_23_E12.g1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_23_E12_A029 5', mRNA sequence
Length = 760
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 700 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 641
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 640 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 585
>dbj|BD224332.1| Materials and methods for the modification of plant lignin content
Length = 1961
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 1459 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 1400
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 1399 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 1344
>dbj|BD224366.1| Materials and methods for the modification of plant lignin content
Length = 1960
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 1458 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 1399
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 1398 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 1343
>dbj|BD272988.1| Materials and methods for the modification of isoprenoid content,
compostition and metabolism
Length = 1961
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 1459 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 1400
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 1399 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 1344
>gb|AI812407.1|AI812407 10A6 Pine Lambda Zap Xylem library Pinus taeda cDNA, mRNA sequence
Length = 610
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 141 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 82
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||| ||||||||||| |||||||||||
Sbjct: 81 actatgaagatttcttcgtcatcgtcaatgtatccgacgtcgcctgtgtggagcca 26
>gb|AW290167.1|AW290167 NXNV015G05F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV015G05 5', mRNA sequence
Length = 553
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 146 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 87
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 86 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtgaagcca 31
>gb|AL751078.1|AL751078 AL751078 RS Pinus pinaster cDNA clone RS03G12 similar to
4-COUMARATE--COA LIGASE, mRNA sequence
Length = 627
Score = 56.0 bits (28), Expect = 3e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 759 cgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 595 cgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 556
>gb|BF010576.1|BF010576 NXCI_086_C09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_086_C09 5' similar to Arabidopsis
thaliana sequence At1g65060 4-coumarate:CoA ligase 3
(4CL3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 234
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 177 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 118
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||| ||||||||||| |||||||||||
Sbjct: 117 actatgaagatttcttcgtcatcgtcaatgtatccgacgtcgcctgtgtggagcca 62
>gb|BG526919.1|BG526919 NXPV_057_D07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_057_D07 5' similar to Arabidopsis
thaliana sequence At3g21240 putative 4-coumarate:CoA
ligase 2 see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 550
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 242 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 183
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||| ||||||||||| |||||||||||
Sbjct: 182 actatgaagatttcttcgtcatcgtcaatgtatccgacgtcgcctgtgtggagcca 127
>gb|BI077306.1|BI077306 NXPV_095_D09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_095_D09 5' similar to Arabidopsis
thaliana sequence At3g21240 putative 4-coumarate:CoA
ligase 2 see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 482
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 249 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 190
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||| ||||||||||| |||||||||||
Sbjct: 189 actatgaagatttcttcgtcatcgtcaatgtatccgacgtcgcctgtgtggagcca 134
>gb|BQ702559.1|BQ702559 NXSI_130_A02_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_130_A02 5' similar to Arabidopsis thaliana
sequence At3g21240 putative 4-coumarate:CoA ligase 2 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 553
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 416 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 357
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||| ||||||||||| |||||||||||
Sbjct: 356 actatgaagatttcttcgtcatcgtcaatgtatccgacgtcgcctgtgtggagcca 301
>gb|CD026879.1|CD026879 NXNV015G05 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV015G05 5' similar to Arabidopsis thaliana sequence
At1g65060 4-coumarate:CoA ligase 3 (4CL3) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 553
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 146 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 87
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 86 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtgaagcca 31
>gb|BX679891.1|BX679891 BX679891 RS Pinus pinaster cDNA clone RS35F02, mRNA sequence
Length = 601
Score = 56.0 bits (28), Expect = 3e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 759 cgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 597 cgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 558
>gb|CO159104.1|CO159104 FLD1_11_H06.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_11_H06_A029 3', mRNA sequence
Length = 631
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 184 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 125
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 124 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtgaagcca 69
>gb|CO159169.1|CO159169 FLD1_11_H06.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_11_H06_A029 5', mRNA sequence
Length = 781
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 321 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 262
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 261 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtgaagcca 206
>gb|CO163929.1|CO163929 FLD1_44_E06.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_44_E06_A029 5', mRNA sequence
Length = 815
Score = 56.0 bits (28), Expect = 3e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 759 cgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 746 cgtcatcgtcaatgtacccgacgtcgcctgtgtggagcca 707
>gb|CO200758.1|CO200758 RTCNT2_1_G11.b1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_1_G11_A029 3', mRNA sequence
Length = 675
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 683 tccagctcggcaggggcgacctggaagcccttgtacttgatgagctccttgatgcggtcc 742
|||||||| ||||| || |||||||||||||| || ||||| | |||||| | | |||
Sbjct: 215 tccagctcagcaggagccacctggaagcccttatatttgataatctcctttactctgtcg 156
Query: 743 acgatgaacacgtcgccgtcgtcgtcgatgtacccgacgtcgcccgtgtggagcca 798
|| ||||| | || |||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 155 actatgaagatttcttcgtcatcgtcaatgtacccgacgtcgcctgtgtgaagcca 100
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 101,246
Number of Sequences: 355925
Number of extensions: 101246
Number of successful extensions: 22615
Number of sequences better than 0.5: 143
Number of HSP's better than 0.5 without gapping: 143
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22203
Number of HSP's gapped (non-prelim): 411
length of query: 919
length of database: 217,277,237
effective HSP length: 19
effective length of query: 900
effective length of database: 210,514,662
effective search space: 189463195800
effective search space used: 189463195800
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)