BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2440773.2.1
(1437 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW290281.1|AW290281 NXNV017E04F Nsf Xylem Normal wood Ve... 40 0.25
gb|AW437867.1|AW437867 ST73C09 Pine TriplEx shoot tip libra... 40 0.25
gb|CD026916.1|CD026916 NXNV017E04 Nsf Xylem Normal wood Ver... 40 0.25
gb|CO161310.1|CO161310 FLD1_28_B01.b1_A029 Root flooded Pin... 40 0.25
gb|CO167325.1|CO167325 FLD1_68_F03.b1_A029 Root flooded Pin... 40 0.25
gb|CO167405.1|CO167405 FLD1_68_F03.g1_A029 Root flooded Pin... 40 0.25
gb|CO361729.1|CO361729 NDL2_6_E02.g1_A029 Needles control 2... 40 0.25
gb|DR118504.1|DR118504 RTMG1_17_A03.g1_A029 Roots minus mag... 40 0.25
gb|DR165420.1|DR165420 RTPHOS1_5_A09.b1_A029 Roots minus ph... 40 0.25
gb|DR165496.1|DR165496 RTPHOS1_5_A09.g1_A029 Roots minus ph... 40 0.25
gb|DR181347.1|DR181347 RTMNUT1_38_G12.b2_A029 Roots minus m... 40 0.25
gb|DR686844.1|DR686844 EST1076922 Normalized pine embryo li... 40 0.25
gb|DR690385.1|DR690385 EST1080471 Normalized pine embryo li... 40 0.25
gb|DT636376.1|DT636376 EST1151307 Normalized pine embryo li... 40 0.25
>gb|AW290281.1|AW290281 NXNV017E04F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV017E04 5', mRNA sequence
Length = 469
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 425 gattgtggcatatgcagggt 444
>gb|AW437867.1|AW437867 ST73C09 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST73C09, mRNA sequence
Length = 317
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 91 gattgtggcatatgcagggt 110
>gb|CD026916.1|CD026916 NXNV017E04 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV017E04 5' similar to Arabidopsis thaliana sequence
At5g18650 putative protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 469
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 425 gattgtggcatatgcagggt 444
>gb|CO161310.1|CO161310 FLD1_28_B01.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_28_B01_A029 3', mRNA sequence
Length = 916
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 660 gattgtggcatatgcagggt 641
>gb|CO167325.1|CO167325 FLD1_68_F03.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_68_F03_A029 3', mRNA sequence
Length = 854
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 22 gattgtggcatatgcagggt 41
>gb|CO167405.1|CO167405 FLD1_68_F03.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_68_F03_A029 5', mRNA sequence
Length = 873
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 443 gattgtggcatatgcagggt 462
>gb|CO361729.1|CO361729 NDL2_6_E02.g1_A029 Needles control 2 Pinus taeda cDNA clone
NDL2_6_E02_A029 5', mRNA sequence
Length = 777
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 380 gattgtggcatatgcagggt 399
>gb|DR118504.1|DR118504 RTMG1_17_A03.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_17_A03_A029 5', mRNA sequence
Length = 641
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 218 gattgtggcatatgcagggt 237
>gb|DR165420.1|DR165420 RTPHOS1_5_A09.b1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_5_A09_A029 3', mRNA sequence
Length = 859
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 115 gattgtggcatatgcagggt 134
>gb|DR165496.1|DR165496 RTPHOS1_5_A09.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_5_A09_A029 5', mRNA sequence
Length = 830
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 391 gattgtggcatatgcagggt 410
>gb|DR181347.1|DR181347 RTMNUT1_38_G12.b2_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_38_G12_A029 3', mRNA sequence
Length = 808
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 286 gattgtggcatatgcagggt 267
>gb|DR686844.1|DR686844 EST1076922 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABK47 3' end, mRNA sequence
Length = 710
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 543 gattgtggcatatgcagggt 562
>gb|DR690385.1|DR690385 EST1080471 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWACU46 3' end, mRNA sequence
Length = 912
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 469 gattgtggcatatgcagggt 488
>gb|DT636376.1|DT636376 EST1151307 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMGR13 3' end, mRNA sequence
Length = 842
Score = 40.1 bits (20), Expect = 0.25
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 446 gattgtggcatatgcagggt 465
||||||||||||||||||||
Sbjct: 477 gattgtggcatatgcagggt 496
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 163,029
Number of Sequences: 355925
Number of extensions: 163029
Number of successful extensions: 48063
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48025
Number of HSP's gapped (non-prelim): 38
length of query: 1437
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1418
effective length of database: 210,514,662
effective search space: 298509790716
effective search space used: 298509790716
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)