BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2437739.2.2
         (2231 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|DR056330.1|DR056330  RTCA1_29_C09.g1_A029 Roots minus cal...    52   1e-004
gb|DR683953.1|DR683953  EST1074029 Normalized pine embryo li...    52   1e-004
gb|DT631864.1|DT631864  EST1146795 Normalized pine embryo li...    52   1e-004
gb|CF388487.1|CF388487  RTDR2_3_B06.g1_A021 Loblolly pine ro...    40   0.38 
gb|DR013884.1|DR013884  HEAT1_22_D06.b1_A029 Root at 37 C fo...    40   0.38 
dbj|BD224352.1|  Materials and methods for the modification ...    40   0.38 
dbj|BD224415.1|  Materials and methods for the modification ...    40   0.38 

>gb|DR056330.1|DR056330 RTCA1_29_C09.g1_A029 Roots minus calcium Pinus taeda cDNA clone
           RTCA1_29_C09_A029 5', mRNA sequence
          Length = 604

 Score = 52.0 bits (26), Expect = 1e-004
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 239 ggacctgctggcgcggatgacgctggccgagaaggtcggccagatgacgcagat 292
           |||| |||||||||||||||| ||||| |||||| | || |||||||| |||||
Sbjct: 115 ggacttgctggcgcggatgactctggcagagaagattggacagatgacccagat 168



>gb|DR683953.1|DR683953 EST1074029 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAAN27 3' end, mRNA sequence
          Length = 896

 Score = 52.0 bits (26), Expect = 1e-004
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 239 ggacctgctggcgcggatgacgctggccgagaaggtcggccagatgacgcagat 292
           |||| |||||||||||||||| ||||| |||||| | || |||||||| |||||
Sbjct: 191 ggacttgctggcgcggatgactctggcagagaagattggacagatgacccagat 244



>gb|DT631864.1|DT631864 EST1146795 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMFD63 3' end, mRNA sequence
          Length = 822

 Score = 52.0 bits (26), Expect = 1e-004
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 239 ggacctgctggcgcggatgacgctggccgagaaggtcggccagatgacgcagat 292
           |||| |||||||||||||||| ||||| |||||| | || |||||||| |||||
Sbjct: 199 ggacttgctggcgcggatgactctggcagagaagattggacagatgacccagat 252



>gb|CF388487.1|CF388487 RTDR2_3_B06.g1_A021 Loblolly pine roots recovering from drought DR2
            Pinus taeda cDNA clone RTDR2_3_B06_A021 5', mRNA sequence
          Length = 741

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 1989 aagatgtaccagaactagaagaag 2012
            |||||||||| |||||||||||||
Sbjct: 680  aagatgtacctgaactagaagaag 703



>gb|DR013884.1|DR013884 HEAT1_22_D06.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
           HEAT1_22_D06_A029 3', mRNA sequence
          Length = 658

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 654 tggggccggtgctacgagagctacagcgagga 685
           |||||||| ||||| ||||||||||| |||||
Sbjct: 77  tggggccgctgctatgagagctacagtgagga 46



>dbj|BD224352.1| Materials and methods for the modification of plant lignin content
          Length = 435

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 654 tggggccggtgctacgagagctacagcgagga 685
           |||||||| ||||| ||||||||||| |||||
Sbjct: 182 tggggccgctgctatgagagctacagtgagga 213



>dbj|BD224415.1| Materials and methods for the modification of plant lignin content
          Length = 404

 Score = 40.1 bits (20), Expect = 0.38
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 654 tggggccggtgctacgagagctacagcgagga 685
           |||||||| ||||| ||||||||||| |||||
Sbjct: 151 tggggccgctgctatgagagctacagtgagga 182



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 196,783
Number of Sequences: 355925
Number of extensions: 196783
Number of successful extensions: 51646
Number of sequences better than  0.5: 7
Number of HSP's better than  0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51630
Number of HSP's gapped (non-prelim): 16
length of query: 2231
length of database: 217,277,237
effective HSP length: 20
effective length of query: 2211
effective length of database: 210,158,737
effective search space: 464660967507
effective search space used: 464660967507
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)