BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419471.2.1
(556 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX249081.1|BX249081 BX249081 Pinus pinaster differenciat... 192 1e-047
gb|BX250117.1|BX250117 BX250117 Pinus pinaster differenciat... 192 1e-047
gb|BX250380.1|BX250380 BX250380 Pinus pinaster differenciat... 192 1e-047
gb|BX252881.1|BX252881 BX252881 Pinus pinaster differenciat... 192 1e-047
gb|BX255705.1|BX255705 BX255705 Pinus pinaster differenciat... 192 1e-047
gb|BQ696322.1|BQ696322 NXPV_040_A07_F NXPV (Nsf Xylem Plani... 188 2e-046
gb|CO367246.1|CO367246 RTK1_33_D07.b1_A029 Roots minus pota... 188 2e-046
gb|CO367561.1|CO367561 RTK1_35_C07.b1_A029 Roots minus pota... 188 2e-046
gb|CX647567.1|CX647567 COLD1_17_G11.g1_A029 Root cold Pinus... 188 2e-046
gb|DR016235.1|DR016235 STRS1_8_F09.g1_A034 Shoot tip pitch ... 188 2e-046
gb|DR022233.1|DR022233 STRS1_49_E10.g1_A034 Shoot tip pitch... 188 2e-046
gb|DR080053.1|DR080053 RTFEPL1_19_G11.g1_A029 Roots plus ad... 188 2e-046
gb|DR094426.1|DR094426 STRR1_14_B08.g1_A033 Stem Response R... 188 2e-046
gb|DR160907.1|DR160907 RTFE1_8_E10.g1_A029 Roots minus iron... 188 2e-046
gb|DR385474.1|DR385474 RTHG1_8_H02.g1_A029 Roots plus added... 188 2e-046
gb|AI725188.1|AI725188 1087 PtIFG2 Pinus taeda cDNA clone 9... 184 3e-045
gb|BE451964.1|BE451964 NXCI_006_H02_F NXCI (Nsf Xylem Compr... 184 3e-045
gb|BE496269.1|BE496269 NXCI_022_A07_F NXCI (Nsf Xylem Compr... 184 3e-045
gb|BE520138.1|BE520138 NXCI_027_F04_F NXCI (Nsf Xylem Compr... 184 3e-045
gb|BE657154.1|BE657154 NXCI_064_F10_F NXCI (Nsf Xylem Compr... 184 3e-045
gb|BE810239.1|BE810239 NXCI_061_H09_F NXCI (Nsf Xylem Compr... 184 3e-045
gb|BF186019.1|BF186019 NXCI_132_B09_F NXCI (Nsf Xylem Compr... 184 3e-045
gb|BG040251.1|BG040251 NXSI_110_C01_F NXSI (Nsf Xylem Side ... 184 3e-045
gb|BG275512.1|BG275512 NXSI_139_F08_F NXSI (Nsf Xylem Side ... 184 3e-045
gb|BG318162.1|BG318162 NXPV_011_B12_F NXPV (Nsf Xylem Plani... 184 3e-045
gb|BG318683.1|BG318683 NXPV_017_G07_F NXPV (Nsf Xylem Plani... 184 3e-045
gb|BG319269.1|BG319269 NXPV_019_G11_F NXPV (Nsf Xylem Plani... 184 3e-045
gb|BQ634158.1|BQ634158 NXRV064_E01_F NXRV (Nsf Xylem Root w... 184 3e-045
gb|BQ654428.1|BQ654428 NXRV080_B09_F NXRV (Nsf Xylem Root w... 184 3e-045
gb|BQ655176.1|BQ655176 NXRV091_B03_F NXRV (Nsf Xylem Root w... 184 3e-045
gb|BQ699871.1|BQ699871 NXRV122_F09_F NXRV (Nsf Xylem Root w... 184 3e-045
gb|BQ701746.1|BQ701746 NXSI_120_B05_F NXSI (Nsf Xylem Side ... 184 3e-045
gb|BQ701982.1|BQ701982 NXSI_122_H08_F NXSI (Nsf Xylem Side ... 184 3e-045
gb|BQ702539.1|BQ702539 NXSI_129_G05_F NXSI (Nsf Xylem Side ... 184 3e-045
gb|CF477832.1|CF477832 RTWW3_13_A10.b1_A022 Well-watered lo... 184 3e-045
gb|CO159741.1|CO159741 FLD1_15_C02.g1_A029 Root flooded Pin... 184 3e-045
gb|CO197225.1|CO197225 GEO1_4_E11.g1_A029 Root gravitropism... 184 3e-045
gb|CV032792.1|CV032792 RTNACL1_18_H05.b1_A029 Roots plus ad... 184 3e-045
gb|DR012531.1|DR012531 HEAT1_13_A06.g1_A029 Root at 37 C fo... 184 3e-045
gb|DR020681.1|DR020681 STRS1_38_C12.g1_A034 Shoot tip pitch... 184 3e-045
gb|DR021557.1|DR021557 STRS1_45_B03.g1_A034 Shoot tip pitch... 184 3e-045
gb|DR024469.1|DR024469 STRS1_65_E02.b1_A034 Shoot tip pitch... 184 3e-045
gb|DR050460.1|DR050460 RTBOR1_23_D10.g1_A029 Roots plus add... 184 3e-045
gb|DR054286.1|DR054286 RTCA1_16_A04.g1_A029 Roots minus cal... 184 3e-045
gb|DR070298.1|DR070298 RTDK1_12_A10.g1_A029 Roots, dark Pin... 184 3e-045
gb|DR071258.1|DR071258 RTDK1_18_E11.g1_A029 Roots, dark Pin... 184 3e-045
gb|DR089504.1|DR089504 RTAL1_9_D02.b1_A029 Roots plus added... 184 3e-045
gb|DR091075.1|DR091075 RTAL1_19_F03.b1_A029 Roots plus adde... 184 3e-045
gb|DR091208.1|DR091208 RTAL1_20_C04.b1_A029 Roots plus adde... 184 3e-045
gb|DR096860.1|DR096860 STRR1_30_G09.g1_A033 Stem Response R... 184 3e-045
gb|DR097142.1|DR097142 STRR1_32_F12.g1_A033 Stem Response R... 184 3e-045
gb|DR387679.1|DR387679 RTHG1_23_A03.g2_A029 Roots plus adde... 184 3e-045
gb|DR694746.1|DR694746 EST1084838 Normalized pine embryo li... 184 3e-045
gb|DR742402.1|DR742402 RTCU1_3_F11.g2_A029 Roots plus added... 184 3e-045
gb|DT638975.1|DT638975 EST1153906 Normalized pine embryo li... 184 3e-045
gb|AY670614.1| Pinus taeda isolate 16 S-adenosyl methionine... 184 3e-045
gb|AY670615.1| Pinus taeda isolate 6 S-adenosyl methionine ... 184 3e-045
gb|AY670616.1| Pinus taeda isolate 4 S-adenosyl methionine ... 184 3e-045
gb|AY670617.1| Pinus taeda isolate 26 S-adenosyl methionine... 184 3e-045
gb|AY670618.1| Pinus taeda isolate 9 S-adenosyl methionine ... 184 3e-045
gb|AY670619.1| Pinus taeda isolate 23 S-adenosyl methionine... 184 3e-045
gb|AY670620.1| Pinus taeda isolate 22 S-adenosyl methionine... 184 3e-045
gb|AY670621.1| Pinus taeda isolate 32 S-adenosyl methionine... 184 3e-045
gb|AY670622.1| Pinus taeda isolate 18 S-adenosyl methionine... 184 3e-045
gb|AY670623.1| Pinus taeda isolate 21 S-adenosyl methionine... 184 3e-045
gb|AY670624.1| Pinus taeda isolate 31 S-adenosyl methionine... 184 3e-045
gb|AY670625.1| Pinus taeda isolate 5 S-adenosyl methionine ... 184 3e-045
gb|AY670626.1| Pinus taeda isolate 15 S-adenosyl methionine... 184 3e-045
gb|AY670627.1| Pinus taeda isolate 20 S-adenosyl methionine... 184 3e-045
gb|AY670628.1| Pinus taeda isolate 12 S-adenosyl methionine... 184 3e-045
gb|AY670629.1| Pinus taeda isolate 24 S-adenosyl methionine... 184 3e-045
gb|AY670630.1| Pinus taeda isolate 11 S-adenosyl methionine... 184 3e-045
gb|AY670631.1| Pinus taeda isolate 7 S-adenosyl methionine ... 184 3e-045
gb|AY670632.1| Pinus taeda isolate 25 S-adenosyl methionine... 184 3e-045
gb|AY670633.1| Pinus taeda isolate 13 S-adenosyl methionine... 184 3e-045
gb|AY670634.1| Pinus taeda isolate 30 S-adenosyl methionine... 184 3e-045
gb|AY670635.1| Pinus taeda isolate 14 S-adenosyl methionine... 184 3e-045
gb|AY670636.1| Pinus taeda isolate 10 S-adenosyl methionine... 184 3e-045
gb|AY670637.1| Pinus taeda isolate 2 S-adenosyl methionine ... 184 3e-045
gb|AY670638.1| Pinus taeda isolate 3 S-adenosyl methionine ... 184 3e-045
gb|AY670639.1| Pinus taeda isolate 19 S-adenosyl methionine... 184 3e-045
gb|AY670640.1| Pinus taeda isolate 28 S-adenosyl methionine... 184 3e-045
gb|AY670641.1| Pinus taeda isolate 8 S-adenosyl methionine ... 184 3e-045
gb|AY670642.1| Pinus taeda isolate 17 S-adenosyl methionine... 184 3e-045
gb|AY670643.1| Pinus taeda isolate 1 S-adenosyl methionine ... 184 3e-045
gb|AY670644.1| Pinus taeda isolate 29 S-adenosyl methionine... 184 3e-045
gb|AY670645.1| Pinus taeda isolate 27 S-adenosyl methionine... 184 3e-045
gb|BQ696196.1|BQ696196 NXPV_039_D05_F NXPV (Nsf Xylem Plani... 182 1e-044
gb|BX254876.1|BX254876 BX254876 Pinus pinaster differenciat... 180 4e-044
gb|BF010743.1|BF010743 NXCI_066_H11_F NXCI (Nsf Xylem Compr... 180 4e-044
gb|BX682921.1|BX682921 BX682921 Pinus pinaster differenciat... 180 4e-044
gb|CO159901.1|CO159901 FLD1_16_F10.g1_A029 Root flooded Pin... 180 4e-044
gb|DR090869.1|DR090869 RTAL1_17_H05.g1_A029 Roots plus adde... 180 4e-044
gb|BE644088.1|BE644088 NXCI_054_D06_F NXCI (Nsf Xylem Compr... 178 2e-043
gb|BG040058.1|BG040058 NXSI_106_A06_F NXSI (Nsf Xylem Side ... 178 2e-043
gb|BG040172.1|BG040172 NXSI_109_C08_F NXSI (Nsf Xylem Side ... 178 2e-043
gb|BG275728.1|BG275728 NXSI_145_B10_F NXSI (Nsf Xylem Side ... 178 2e-043
gb|BG832865.1|BG832865 NXPV_081_F09_F NXPV (Nsf Xylem Plani... 178 2e-043
gb|BQ697932.1|BQ697932 NXPV_062_F06_F NXPV (Nsf Xylem Plani... 178 2e-043
gb|BX251910.1|BX251910 BX251910 Pinus pinaster differenciat... 176 6e-043
gb|BF777936.1|BF777936 NXSI_079_A10_F NXSI (Nsf Xylem Side ... 176 6e-043
gb|BG318748.1|BG318748 NXPV_016_C06_F NXPV (Nsf Xylem Plani... 176 6e-043
gb|BQ698311.1|BQ698311 NXPV_068_B12_F NXPV (Nsf Xylem Plani... 176 6e-043
gb|DR025135.1|DR025135 STRS1_69_G03.g1_A034 Shoot tip pitch... 176 6e-043
gb|BM427941.1|BM427941 NXRV_006_E07_F NXRV (Nsf Xylem Root ... 174 2e-042
gb|BE582217.1|BE582217 NXCI_026_E03_F NXCI (Nsf Xylem Compr... 172 1e-041
gb|BF778602.1|BF778602 NXSI_088_E11_F NXSI (Nsf Xylem Side ... 172 1e-041
gb|BG275772.1|BG275772 NXSI_145_G01_F NXSI (Nsf Xylem Side ... 172 1e-041
gb|BI077350.1|BI077350 NXPV_096_A05_F NXPV (Nsf Xylem Plani... 172 1e-041
gb|DR021705.1|DR021705 STRS1_46_A05.g1_A034 Shoot tip pitch... 172 1e-041
gb|BF169846.1|BF169846 NXCI_127_A09_F NXCI (Nsf Xylem Compr... 170 4e-041
gb|BG317884.1|BG317884 NXPV_006_G10_F NXPV (Nsf Xylem Plani... 170 4e-041
gb|BE520021.1|BE520021 NXCI_028_C01_F NXCI (Nsf Xylem Compr... 168 2e-040
gb|BI077324.1|BI077324 NXPV_095_F09_F NXPV (Nsf Xylem Plani... 168 2e-040
gb|BQ699132.1|BQ699132 NXRV119_H03_F NXRV (Nsf Xylem Root w... 168 2e-040
gb|BX254235.1|BX254235 BX254235 Pinus pinaster differenciat... 165 2e-039
gb|BX254700.1|BX254700 BX254700 Pinus pinaster differenciat... 165 2e-039
gb|BI077076.1|BI077076 NXPV_087_B08_F NXPV (Nsf Xylem Plani... 165 2e-039
gb|U38186.1|PBU38186 Pinus banksiana root specific S-adenos... 165 2e-039
gb|AL749596.1|AL749596 AL749596 AN Pinus pinaster cDNA clon... 163 9e-039
gb|AL749707.1|AL749707 AL749707 AN Pinus pinaster cDNA clon... 163 9e-039
gb|BF221324.1|BF221324 NXCI_157_D06_F NXCI (Nsf Xylem Compr... 163 9e-039
gb|BX680993.1|BX680993 BX680993 RS Pinus pinaster cDNA clon... 163 9e-039
gb|CX714552.1|CX714552 RTPQ1_23_A01.g1_A032 Roots treated w... 163 9e-039
gb|BF220790.1|BF220790 NXCI_150_H08_F NXCI (Nsf Xylem Compr... 161 4e-038
gb|BF517210.1|BF517210 NXSI_011_F12_F NXSI (Nsf Xylem Side ... 161 4e-038
gb|BF778257.1|BF778257 NXSI_082_C07_F NXSI (Nsf Xylem Side ... 161 4e-038
gb|BG040546.1|BG040546 NXSI_112_D09_F NXSI (Nsf Xylem Side ... 161 4e-038
gb|BG317430.1|BG317430 NXPV_001_G01_F NXPV (Nsf Xylem Plani... 161 4e-038
gb|BQ635103.1|BQ635103 NXRV077_A09_F NXRV (Nsf Xylem Root w... 161 4e-038
gb|BQ655353.1|BQ655353 NXRV093_C06_F NXRV (Nsf Xylem Root w... 161 4e-038
gb|CF667503.1|CF667503 RTCNT1_30_E05.g1_A029 Root control P... 161 4e-038
gb|CO164996.1|CO164996 FLD1_51_D08.g1_A029 Root flooded Pin... 161 4e-038
gb|DR099797.1|DR099797 STRR1_58_D10.g1_A033 Stem Response R... 161 4e-038
gb|AA557000.1|AA557000 842 Loblolly pine N Pinus taeda cDNA... 159 1e-037
gb|BE662433.1|BE662433 ST85/ST85B10 Pine TriplEx shoot tip ... 159 1e-037
gb|BF221281.1|BF221281 NXCI_156_H03_F NXCI (Nsf Xylem Compr... 159 1e-037
gb|BI076880.1|BI076880 NXPV_082_B05_F NXPV (Nsf Xylem Plani... 159 1e-037
gb|AI812344.1|AI812344 1C11 Pine Lambda Zap Xylem library P... 157 6e-037
gb|BF517737.1|BF517737 NXSI_029_F06_F NXSI (Nsf Xylem Side ... 157 6e-037
gb|BQ291020.1|BQ291020 NXRV054_F05_F NXRV (Nsf Xylem Root w... 157 6e-037
gb|BQ655528.1|BQ655528 NXRV095_G09_F NXRV (Nsf Xylem Root w... 157 6e-037
gb|BQ655861.1|BQ655861 NXRV100_C02_F NXRV (Nsf Xylem Root w... 157 6e-037
gb|BQ700703.1|BQ700703 NXRV110_C01_F NXRV (Nsf Xylem Root w... 157 6e-037
gb|CF393817.1|CF393817 RTDS2_1_G08.g1_A021 Drought-stressed... 157 6e-037
gb|CF395569.1|CF395569 RTDS2_12_B08.g1_A021 Drought-stresse... 157 6e-037
gb|CF476783.1|CF476783 RTWW3_3_E12.g1_A022 Well-watered lob... 157 6e-037
gb|CF477610.1|CF477610 RTWW3_8_E12.g1_A022 Well-watered lob... 157 6e-037
gb|CF478532.1|CF478532 RTWW3_20_B06.g1_A022 Well-watered lo... 157 6e-037
gb|CF479357.1|CF479357 RTWW3_23_B11.g1_A022 Well-watered lo... 157 6e-037
gb|CF670318.1|CF670318 RTCNT1_49_A12.g1_A029 Root control P... 157 6e-037
gb|CF670634.1|CF670634 RTCNT1_51_B12.g1_A029 Root control P... 157 6e-037
gb|CO196713.1|CO196713 GEO1_1_B11.b1_A029 Root gravitropism... 157 6e-037
gb|CO200137.1|CO200137 GEO2_5_D09.g1_A032 Root gravitropism... 157 6e-037
gb|CO363940.1|CO363940 RTK1_12_E07.g1_A029 Roots minus pota... 157 6e-037
gb|CO364660.1|CO364660 RTK1_21_B08.b1_A029 Roots minus pota... 157 6e-037
gb|CO364908.1|CO364908 RTK1_22_B10.g1_A029 Roots minus pota... 157 6e-037
gb|CO365715.1|CO365715 RTK1_18_F05.g1_A029 Roots minus pota... 157 6e-037
gb|CO367139.1|CO367139 RTK1_32_A06.g1_A029 Roots minus pota... 157 6e-037
gb|CO370251.1|CO370251 RTK1_66_D05.g1_A029 Roots minus pota... 157 6e-037
gb|CX646170.1|CX646170 COLD1_7_F01.g1_A029 Root cold Pinus ... 157 6e-037
gb|CX652469.1|CX652469 COLD1_59_F09.b1_A029 Root cold Pinus... 157 6e-037
gb|CX712461.1|CX712461 RTPQ1_2_D12.g2_A032 Roots treated wi... 157 6e-037
gb|DR011115.1|DR011115 HEAT1_3_C05.g1_A029 Root at 37 C for... 157 6e-037
gb|DR012064.1|DR012064 HEAT1_9_H11.g1_A029 Root at 37 C for... 157 6e-037
gb|DR012871.1|DR012871 HEAT1_15_B11.g1_A029 Root at 37 C fo... 157 6e-037
gb|DR014448.1|DR014448 HEAT1_49_C05.g1_A029 Root at 37 C fo... 157 6e-037
gb|DR014756.1|DR014756 HEAT1_51_A05.g1_A029 Root at 37 C fo... 157 6e-037
gb|DR049694.1|DR049694 RTBOR1_18_A08.g1_A029 Roots plus add... 157 6e-037
gb|DR057741.1|DR057741 RTNIT1_7_C04.g1_A029 Roots minus nit... 157 6e-037
gb|DR057949.1|DR057949 RTNIT1_8_F08.g1_A029 Roots minus nit... 157 6e-037
gb|DR059577.1|DR059577 RTNIT1_18_B10.g1_A029 Roots minus ni... 157 6e-037
gb|DR080420.1|DR080420 RTFEPL1_22_C01.g1_A029 Roots plus ad... 157 6e-037
gb|DR081156.1|DR081156 RTFEPL1_27_G04.g1_A029 Roots plus ad... 157 6e-037
gb|DR090266.1|DR090266 RTAL1_13_H02.g1_A029 Roots plus adde... 157 6e-037
gb|DR090413.1|DR090413 RTAL1_14_H02.g1_A029 Roots plus adde... 157 6e-037
gb|DR091220.1|DR091220 RTAL1_20_D07.b1_A029 Roots plus adde... 157 6e-037
gb|DR110703.1|DR110703 RTS1_12_A06.g1_A029 Roots minus sulf... 157 6e-037
gb|DR160066.1|DR160066 RTFE1_3_B08.g1_A029 Roots minus iron... 157 6e-037
gb|DR161265.1|DR161265 RTFE1_10_G02.g1_A029 Roots minus iro... 157 6e-037
gb|DR163323.1|DR163323 RTFE1_42_F07.b1_A029 Roots minus iro... 157 6e-037
gb|DR166975.1|DR166975 RTPHOS1_15_G04.g1_A029 Roots minus p... 157 6e-037
gb|DR167113.1|DR167113 RTPHOS1_16_F08.g1_A029 Roots minus p... 157 6e-037
gb|DR167770.1|DR167770 RTPHOS1_20_H12.g1_A029 Roots minus p... 157 6e-037
gb|DR177463.1|DR177463 RTMNUT1_5_B01.g1_A029 Roots minus mi... 157 6e-037
gb|DR178699.1|DR178699 RTMNUT1_13_A05.g1_A029 Roots minus m... 157 6e-037
gb|DR180468.1|DR180468 RTMNUT1_28_G04.g1_A029 Roots minus m... 157 6e-037
gb|DR181583.1|DR181583 RTMNUT1_39_G01.g2_A029 Roots minus m... 157 6e-037
gb|DR743376.1|DR743376 RTCU1_15_A06.g1_A029 Roots plus adde... 157 6e-037
gb|AF187821.1|AF187821 Pinus contorta S-adenosylmethionine ... 157 6e-037
gb|AW043192.1|AW043192 ST30D09 Pine TriplEx shoot tip libra... 155 2e-036
gb|BX250044.1|BX250044 BX250044 Pinus pinaster differenciat... 155 2e-036
gb|BX250335.1|BX250335 BX250335 Pinus pinaster differenciat... 155 2e-036
gb|BX251034.1|BX251034 BX251034 Pinus pinaster differenciat... 155 2e-036
gb|BX254106.1|BX254106 BX254106 Pinus pinaster differenciat... 155 2e-036
gb|BX254288.1|BX254288 BX254288 Pinus pinaster differenciat... 155 2e-036
gb|BF060491.1|BF060491 NXCI_115_F02_F NXCI (Nsf Xylem Compr... 155 2e-036
gb|BQ698307.1|BQ698307 NXPV_068_B06_F NXPV (Nsf Xylem Plani... 155 2e-036
gb|BQ701536.1|BQ701536 NXSI_065_G06_F NXSI (Nsf Xylem Side ... 155 2e-036
gb|BX678089.1|BX678089 BX678089 RN Pinus pinaster cDNA clon... 155 2e-036
gb|CR393355.1|CR393355 CR393355 RN Pinus pinaster cDNA clon... 155 2e-036
gb|CO166766.1|CO166766 FLD1_64_H01.b1_A029 Root flooded Pin... 155 2e-036
gb|BQ699122.1|BQ699122 NXRV119_G02_F NXRV (Nsf Xylem Root w... 153 9e-036
gb|CF672418.1|CF672418 RTCNT1_63_A05.g1_A029 Root control P... 151 4e-035
gb|CO196737.1|CO196737 GEO1_1_E11.b1_A029 Root gravitropism... 151 4e-035
gb|AW888162.1|AW888162 NXNV_129_H09_F Nsf Xylem Normal wood... 149 1e-034
gb|BF169687.1|BF169687 NXCI_126_E03_F NXCI (Nsf Xylem Compr... 149 1e-034
gb|CF395702.1|CF395702 RTDS2_16_A03.g1_A021 Drought-stresse... 149 1e-034
gb|CF663715.1|CF663715 RTCNT1_4_E04.g1_A029 Root control Pi... 149 1e-034
gb|CF664552.1|CF664552 RTCNT1_10_C03.g1_A029 Root control P... 149 1e-034
gb|CF666389.1|CF666389 RTCNT1_22_H12.g1_A029 Root control P... 149 1e-034
gb|CF668940.1|CF668940 RTCNT1_39_C11.g1_A029 Root control P... 149 1e-034
gb|CO162339.1|CO162339 FLD1_34_E06.g1_A029 Root flooded Pin... 149 1e-034
gb|CO200462.1|CO200462 GEO2_7_C12.g1_A032 Root gravitropism... 149 1e-034
gb|CO201548.1|CO201548 RTCNT2_6_B09.g1_A029 Root control 2 ... 149 1e-034
gb|CO364461.1|CO364461 RTK1_15_G08.g1_A029 Roots minus pota... 149 1e-034
gb|CO366406.1|CO366406 RTK1_27_E01.g1_A029 Roots minus pota... 149 1e-034
gb|CO370116.1|CO370116 RTK1_65_D01.g1_A029 Roots minus pota... 149 1e-034
gb|CV031658.1|CV031658 RTNACL1_2_H08.g1_A029 Roots plus add... 149 1e-034
gb|CV032864.1|CV032864 RTNACL1_18_F12.g1_A029 Roots plus ad... 149 1e-034
gb|CV034963.1|CV034963 RTNACL1_12_F06.g1_A029 Roots plus ad... 149 1e-034
gb|DR023308.1|DR023308 STRS1_56_F03.g1_A034 Shoot tip pitch... 149 1e-034
gb|DR049753.1|DR049753 RTBOR1_18_G10.g1_A029 Roots plus add... 149 1e-034
gb|DR054035.1|DR054035 RTCA1_14_G07.g1_A029 Roots minus cal... 149 1e-034
gb|DR054363.1|DR054363 RTCA1_16_H04.g1_A029 Roots minus cal... 149 1e-034
gb|DR060540.1|DR060540 RTNIT1_28_B02.g1_A029 Roots minus ni... 149 1e-034
gb|DR071597.1|DR071597 RTDK1_20_H11.g1_A029 Roots, dark Pin... 149 1e-034
gb|DR078730.1|DR078730 RTFEPL1_6_B07.g1_A029 Roots plus add... 149 1e-034
gb|DR088430.1|DR088430 RTAL1_1_E04.g1_A029 Roots plus added... 149 1e-034
gb|DR162371.1|DR162371 RTFE1_17_A01.g1_A029 Roots minus iro... 149 1e-034
gb|BE582286.1|BE582286 NXCI_031_E05_F NXCI (Nsf Xylem Compr... 147 6e-034
gb|BX677093.1|BX677093 BX677093 RN Pinus pinaster cDNA clon... 147 6e-034
gb|CR394164.1|CR394164 CR394164 RN Pinus pinaster cDNA clon... 147 6e-034
gb|BI644000.1|BI644000 NXPV_137_B01_F NXPV (Nsf Xylem Plani... 145 2e-033
gb|DR058667.1|DR058667 RTNIT1_13_E03.b1_A029 Roots minus ni... 145 2e-033
gb|CO168000.1|CO168000 FLD1_72_D05.g1_A029 Root flooded Pin... 141 3e-032
gb|CO362293.1|CO362293 RTK1_2_D07.g1_A029 Roots minus potas... 141 3e-032
gb|DR110417.1|DR110417 RTS1_10_F05.g1_A029 Roots minus sulf... 141 3e-032
gb|DR743086.1|DR743086 RTCU1_13_B02.g1_A029 Roots plus adde... 141 3e-032
gb|BE451747.1|BE451747 NXCI_001_F07_F NXCI (Nsf Xylem Compr... 139 1e-031
gb|AW870204.1|AW870204 NXNV_125_E05_F Nsf Xylem Normal wood... 137 5e-031
gb|BE241148.1|BE241148 NXNV_173_D10_F Nsf Xylem Normal wood... 137 5e-031
gb|BE451911.1|BE451911 NXCI_006_B11_F NXCI (Nsf Xylem Compr... 137 5e-031
gb|BF060452.1|BF060452 NXCI_115_A09_F NXCI (Nsf Xylem Compr... 137 5e-031
gb|BF517161.1|BF517161 NXSI_011_B11_F NXSI (Nsf Xylem Side ... 137 5e-031
gb|CF478333.1|CF478333 RTWW3_18_G12.g1_A022 Well-watered lo... 137 5e-031
gb|CV031585.1|CV031585 RTNACL1_2_A12.g1_A029 Roots plus add... 137 5e-031
gb|CX715673.1|CX715673 RTPQ1_35_F08.g1_A032 Roots treated w... 137 5e-031
gb|DR019089.1|DR019089 STRS1_27_F03.g1_A034 Shoot tip pitch... 137 5e-031
gb|DR071684.1|DR071684 RTDK1_21_A11.g1_A029 Roots, dark Pin... 137 5e-031
gb|DR165078.1|DR165078 RTPHOS1_2_A03.g1_A029 Roots minus ph... 137 5e-031
gb|BX255072.1|BX255072 BX255072 Pinus pinaster differenciat... 135 2e-030
gb|AW888218.1|AW888218 NXNV_105_C10_F Nsf Xylem Normal wood... 135 2e-030
gb|BE607233.1|BE607233 NXCI_034_D09_F NXCI (Nsf Xylem Compr... 135 2e-030
gb|AA556839.1|AA556839 681 Loblolly pine C Pinus taeda cDNA... 133 8e-030
gb|BF060478.1|BF060478 NXCI_115_D10_F NXCI (Nsf Xylem Compr... 133 8e-030
gb|BG319197.1|BG319197 NXPV_024_H05_F NXPV (Nsf Xylem Plani... 133 8e-030
gb|AW042653.1|AW042653 ST24D06 Pine TriplEx shoot tip libra... 129 1e-028
gb|BX677737.1|BX677737 BX677737 RN Pinus pinaster cDNA clon... 129 1e-028
gb|CR393124.1|CR393124 CR393124 RN Pinus pinaster cDNA clon... 129 1e-028
gb|CO198893.1|CO198893 GEO1_17_G11.b1_A029 Root gravitropis... 129 1e-028
gb|CO362610.1|CO362610 RTK1_4_D11.g1_A029 Roots minus potas... 129 1e-028
gb|DR051505.1|DR051505 RTBOR1_30_C05.g1_A029 Roots plus add... 129 1e-028
gb|BE762009.1|BE762009 NXCI_075_H08_F NXCI (Nsf Xylem Compr... 127 5e-028
gb|BF610299.1|BF610299 NXSI_057_E09_F NXSI (Nsf Xylem Side ... 127 5e-028
gb|BQ696978.1|BQ696978 NXPV_047_F05_F NXPV (Nsf Xylem Plani... 127 5e-028
gb|BQ698114.1|BQ698114 NXPV_064_F11_F NXPV (Nsf Xylem Plani... 127 5e-028
gb|BQ700162.1|BQ700162 NXRV102_A03_F NXRV (Nsf Xylem Root w... 127 5e-028
gb|AI725233.1|AI725233 1252 PtIFG2 Pinus taeda cDNA clone 9... 125 2e-027
gb|AL749588.1|AL749588 AL749588 AN Pinus pinaster cDNA clon... 125 2e-027
gb|BE997115.1|BE997115 NXCI_099_H02_F NXCI (Nsf Xylem Compr... 125 2e-027
gb|BQ701830.1|BQ701830 NXSI_121_A08_F NXSI (Nsf Xylem Side ... 125 2e-027
gb|CF671294.1|CF671294 RTCNT1_56_D02.b1_A029 Root control P... 125 2e-027
gb|DR070943.1|DR070943 RTDK1_16_C06.g1_A029 Roots, dark Pin... 125 2e-027
gb|DR166142.1|DR166142 RTPHOS1_9_E11.g2_A029 Roots minus ph... 125 2e-027
gb|BE656895.1|BE656895 NXCI_057_G06_F NXCI (Nsf Xylem Compr... 123 8e-027
gb|BF220535.1|BF220535 NXCI_148_A06_F NXCI (Nsf Xylem Compr... 123 8e-027
gb|BF777207.1|BF777207 NXSI_066_E03_F NXSI (Nsf Xylem Side ... 123 8e-027
gb|DR177245.1|DR177245 RTMNUT1_4_C04.b1_A029 Roots minus mi... 123 8e-027
gb|BE187447.1|BE187447 NXNV_98_C11_F Nsf Xylem Normal wood ... 121 3e-026
gb|BF778943.1|BF778943 NXSI_091_C01_F NXSI (Nsf Xylem Side ... 121 3e-026
gb|DR053699.1|DR053699 RTCA1_12_F09.g1_A029 Roots minus cal... 121 3e-026
gb|BF169424.1|BF169424 NXCI_121_A07_F NXCI (Nsf Xylem Compr... 119 1e-025
gb|DR023918.1|DR023918 STRS1_60_H10.g1_A034 Shoot tip pitch... 119 1e-025
gb|DR099730.1|DR099730 STRR1_58_C05.b1_A033 Stem Response R... 119 1e-025
gb|BX666055.1|BX666055 BX666055 RN Pinus pinaster cDNA clon... 117 5e-025
gb|AW697704.1|AW697704 ST65F09 Pine TriplEx shoot tip libra... 115 2e-024
gb|BF169685.1|BF169685 NXCI_126_D11_F NXCI (Nsf Xylem Compr... 115 2e-024
gb|BQ696674.1|BQ696674 NXPV_044_B04_F NXPV (Nsf Xylem Plani... 115 2e-024
gb|CF663404.1|CF663404 RTCNT1_2_D06.g1_A029 Root control Pi... 115 2e-024
gb|BE657015.1|BE657015 NXCI_046_D10_F NXCI (Nsf Xylem Compr... 113 8e-024
gb|BG039350.1|BG039350 NXSI_098_A10_F NXSI (Nsf Xylem Side ... 113 8e-024
gb|CX712600.1|CX712600 RTPQ1_3_B08.g1_A032 Roots treated wi... 113 8e-024
dbj|BD262189.1| Composition and methods for the modificatio... 113 8e-024
dbj|BD262190.1| Composition and methods for the modificatio... 113 8e-024
dbj|DD014327.1| Compositions and Methods for the Modificati... 113 8e-024
dbj|DD014328.1| Compositions and Methods for the Modificati... 113 8e-024
gb|BE520113.1|BE520113 NXCI_027_A02_F NXCI (Nsf Xylem Compr... 109 1e-022
gb|BE656851.1|BE656851 NXCI_056_A05_F NXCI (Nsf Xylem Compr... 109 1e-022
gb|BE758711.1|BE758711 NXCI_059_C11_F NXCI (Nsf Xylem Compr... 109 1e-022
gb|DR389165.1|DR389165 RTHG1_32_G10.g1_A029 Roots plus adde... 109 1e-022
gb|BG319291.1|BG319291 NXPV_026_B08_F NXPV (Nsf Xylem Plani... 107 5e-022
gb|BQ290794.1|BQ290794 NXRV049_E09_F NXRV (Nsf Xylem Root w... 107 5e-022
gb|AW010600.1|AW010600 ST08F07 Pine TriplEx shoot tip libra... 105 2e-021
gb|CX651415.1|CX651415 COLD1_52_F03.b1_A029 Root cold Pinus... 105 2e-021
gb|BF220993.1|BF220993 NXCI_153_F02_F NXCI (Nsf Xylem Compr... 103 7e-021
gb|BG318639.1|BG318639 NXPV_017_C01_F NXPV (Nsf Xylem Plani... 103 7e-021
gb|BQ701257.1|BQ701257 NXSI_061_D10_F NXSI (Nsf Xylem Side ... 103 7e-021
gb|CX651943.1|CX651943 COLD1_55_G09.g1_A029 Root cold Pinus... 103 7e-021
gb|CO164372.1|CO164372 FLD1_47_D03.g1_A029 Root flooded Pin... 101 3e-020
gb|AW497800.1|AW497800 PC02D07 Pine TriplEx pollen cone lib... 100 1e-019
gb|BX248982.1|BX248982 BX248982 Pinus pinaster differenciat... 100 1e-019
gb|BG526925.1|BG526925 NXPV_057_E01_F NXPV (Nsf Xylem Plani... 100 1e-019
gb|BI643780.1|BI643780 NXPV_134_E06_F NXPV (Nsf Xylem Plani... 100 1e-019
gb|CD021469.1|CD021469 NXNV_145_D10_F Nsf Xylem Normal wood... 100 1e-019
gb|CD022673.1|CD022673 NXPV_076_C02_F NXPV (Nsf Xylem Plani... 100 1e-019
gb|AW784114.1|AW784114 NXNV_103_C06_F Nsf Xylem Normal wood... 98 5e-019
gb|BF169494.1|BF169494 NXCI_120_A05_F NXCI (Nsf Xylem Compr... 96 2e-018
gb|CR393022.1|CR393022 CR393022 RN Pinus pinaster cDNA clon... 96 2e-018
gb|AW437892.1|AW437892 ST73H10 Pine TriplEx shoot tip libra... 94 7e-018
gb|BE644235.1|BE644235 NXCI_051_G04_F NXCI (Nsf Xylem Compr... 94 7e-018
gb|BX681919.1|BX681919 BX681919 RS Pinus pinaster cDNA clon... 94 7e-018
gb|BF609334.1|BF609334 NXSI_045_B02_F NXSI (Nsf Xylem Side ... 92 3e-017
gb|BX253238.1|BX253238 BX253238 Pinus pinaster differenciat... 90 1e-016
gb|BX253239.1|BX253239 BX253239 Pinus pinaster differenciat... 90 1e-016
gb|CF672884.1|CF672884 RTCNT1_74_D03.g1_A029 Root control P... 90 1e-016
gb|CX715498.1|CX715498 RTPQ1_34_C07.g1_A032 Roots treated w... 90 1e-016
gb|DR011965.1|DR011965 HEAT1_9_D07.b1_A029 Root at 37 C for... 90 1e-016
gb|DR057971.1|DR057971 RTNIT1_8_H07.g1_A029 Roots minus nit... 90 1e-016
gb|DR071909.1|DR071909 RTDK1_22_G11.g1_A029 Roots, dark Pin... 90 1e-016
gb|BG039124.1|BG039124 NXSI_095_A12_F NXSI (Nsf Xylem Side ... 88 4e-016
gb|BF169778.1|BF169778 NXCI_129_C02_F NXCI (Nsf Xylem Compr... 86 2e-015
gb|CF393893.1|CF393893 RTDS2_2_D07.b1_A021 Drought-stressed... 84 7e-015
gb|CF666805.1|CF666805 RTCNT1_26_F12.b1_A029 Root control P... 84 7e-015
gb|AW011254.1|AW011254 ST18F04 Pine TriplEx shoot tip libra... 82 3e-014
gb|BE662428.1|BE662428 ST85/ST85B03 Pine TriplEx shoot tip ... 82 3e-014
gb|BX248790.1|BX248790 BX248790 Pinus pinaster differenciat... 82 3e-014
gb|BX251167.1|BX251167 BX251167 Pinus pinaster differenciat... 82 3e-014
gb|BX251203.1|BX251203 BX251203 Pinus pinaster differenciat... 82 3e-014
gb|BQ654983.1|BQ654983 NXRV088_G03_F NXRV (Nsf Xylem Root w... 82 3e-014
gb|CD022593.1|CD022593 NXPV_069_F09_F NXPV (Nsf Xylem Plani... 82 3e-014
gb|CF669087.1|CF669087 RTCNT1_40_C05.g1_A029 Root control P... 82 3e-014
gb|CF670158.1|CF670158 RTCNT1_48_A08.g1_A029 Root control P... 82 3e-014
gb|CO366424.1|CO366424 RTK1_27_F10.g1_A029 Roots minus pota... 82 3e-014
gb|DR053870.1|DR053870 RTCA1_13_G06.g1_A029 Roots minus cal... 82 3e-014
gb|DR071704.1|DR071704 RTDK1_21_C11.g1_A029 Roots, dark Pin... 82 3e-014
gb|DR117899.1|DR117899 RTMG1_9_H10.g1_A029 Roots minus magn... 82 3e-014
gb|AW587780.1|AW587780 ST66H01 Pine TriplEx shoot tip libra... 80 1e-013
gb|CD020372.1|CD020372 NXNV_063_B07_F Nsf Xylem Normal wood... 80 1e-013
gb|CD016232.1|CD016232 NXCI_025_D12_F NXCI (Nsf Xylem Compr... 78 4e-013
gb|AI920224.1|AI920224 1754 Pine Lambda Zap Xylem library P... 74 7e-012
gb|AW698064.1|AW698064 NXNV_078_D10_F Nsf Xylem Normal wood... 74 7e-012
gb|BE496454.1|BE496454 NXCI_018_C10_F NXCI (Nsf Xylem Compr... 74 7e-012
gb|BE762179.1|BE762179 NXCI_083_A07_F NXCI (Nsf Xylem Compr... 74 7e-012
gb|BF010715.1|BF010715 NXCI_066_F05_F NXCI (Nsf Xylem Compr... 74 7e-012
gb|BF221227.1|BF221227 NXCI_156_C04_F NXCI (Nsf Xylem Compr... 74 7e-012
gb|BQ290990.1|BQ290990 NXRV054_C09_F NXRV (Nsf Xylem Root w... 74 7e-012
gb|BQ700774.1|BQ700774 NXRV111_B07_F NXRV (Nsf Xylem Root w... 74 7e-012
gb|BQ701069.1|BQ701069 NXRV115_B06_F NXRV (Nsf Xylem Root w... 74 7e-012
gb|CO167092.1|CO167092 FLD1_66_F05.g1_A029 Root flooded Pin... 74 7e-012
gb|CV137851.1|CV137851 EST849060 Sequencing ESTs from loblo... 74 7e-012
gb|CV138750.1|CV138750 EST849959 Sequencing ESTs from loblo... 74 7e-012
gb|CX651883.1|CX651883 COLD1_55_A06.g1_A029 Root cold Pinus... 74 7e-012
gb|DR022315.1|DR022315 STRS1_50_F10.b1_A034 Shoot tip pitch... 74 7e-012
gb|DR056650.1|DR056650 RTCA1_31_E01.g1_A029 Roots minus cal... 74 7e-012
gb|DR116936.1|DR116936 RTMG1_3_E06.g1_A029 Roots minus magn... 74 7e-012
gb|DT626497.1|DT626497 EST1158421 Sequencing ESTs from lobl... 74 7e-012
gb|DT624455.1|DT624455 EST1158742 Sequencing ESTs from lobl... 74 7e-012
gb|BF517135.1|BF517135 NXSI_009_H08_F NXSI (Nsf Xylem Side ... 72 3e-011
gb|CD022280.1|CD022280 NXPV_034_C03_F NXPV (Nsf Xylem Plani... 72 3e-011
gb|CD023235.1|CD023235 NXPV_103_F04_F NXPV (Nsf Xylem Plani... 72 3e-011
gb|CD026075.1|CD026075 NXSI_096_D02_F NXSI (Nsf Xylem Side ... 72 3e-011
gb|AW011525.1|AW011525 ST21H03 Pine TriplEx shoot tip libra... 70 1e-010
gb|AW290572.1|AW290572 NXNV031E08F Nsf Xylem Normal wood Ve... 70 1e-010
gb|BG318015.1|BG318015 NXPV_008_E08_F NXPV (Nsf Xylem Plani... 70 1e-010
gb|BG318492.1|BG318492 NXPV_014_D09_F NXPV (Nsf Xylem Plani... 70 1e-010
gb|BG319119.1|BG319119 NXPV_023_H07_F NXPV (Nsf Xylem Plani... 70 1e-010
gb|BQ633912.1|BQ633912 NXRV062_D03_F NXRV (Nsf Xylem Root w... 70 1e-010
gb|CD016077.1|CD016077 NXCI_012_E02_F NXCI (Nsf Xylem Compr... 70 1e-010
gb|CD017347.1|CD017347 NXCI_106_G08_F NXCI (Nsf Xylem Compr... 70 1e-010
gb|CD027236.1|CD027236 NXNV031E08 Nsf Xylem Normal wood Ver... 70 1e-010
gb|BE643924.1|BE643924 NXCI_050_B07_F NXCI (Nsf Xylem Compr... 68 4e-010
gb|BE997113.1|BE997113 NXCI_099_G02_F NXCI (Nsf Xylem Compr... 68 4e-010
gb|CD025019.1|CD025019 NXSI_004_G06_F NXSI (Nsf Xylem Side ... 66 2e-009
gb|BX249938.1|BX249938 BX249938 Pinus pinaster differenciat... 64 6e-009
gb|AW783970.1|AW783970 NXNV_096_C05_F Nsf Xylem Normal wood... 64 6e-009
gb|BE582061.1|BE582061 NXCI_023_G06_F NXCI (Nsf Xylem Compr... 64 6e-009
gb|BG039489.1|BG039489 NXSI_099_F12_F NXSI (Nsf Xylem Side ... 64 6e-009
gb|CF396533.1|CF396533 RTDS2_22_H10.g1_A021 Drought-stresse... 64 6e-009
gb|CO363401.1|CO363401 RTK1_9_B11.g1_A029 Roots minus potas... 64 6e-009
gb|CV031798.1|CV031798 RTNACL1_3_F06.g1_A029 Roots plus add... 64 6e-009
gb|DR164015.1|DR164015 RTFE1_46_G09.b1_A029 Roots minus iro... 64 6e-009
gb|DR181074.1|DR181074 RTMNUT1_36_D03.g1_A029 Roots minus m... 64 6e-009
gb|AI812418.1|AI812418 10C6 Pine Lambda Zap Xylem library P... 62 3e-008
gb|BF186132.1|BF186132 NXCI_133_B03_F NXCI (Nsf Xylem Compr... 62 3e-008
gb|AI812567.1|AI812567 13B12 Pine Lambda Zap Xylem library ... 60 1e-007
gb|BF516790.1|BF516790 NXSI_003_D07_F NXSI (Nsf Xylem Side ... 60 1e-007
gb|BG318644.1|BG318644 NXPV_017_C12_F NXPV (Nsf Xylem Plani... 60 1e-007
gb|BQ701314.1|BQ701314 NXSI_062_D02_F NXSI (Nsf Xylem Side ... 60 1e-007
gb|CD023358.1|CD023358 NXPV_135_C01_F NXPV (Nsf Xylem Plani... 60 1e-007
gb|AW698193.1|AW698193 NXNV_074_E09_F Nsf Xylem Normal wood... 58 4e-007
gb|CD017470.1|CD017470 NXCI_118_D06_F NXCI (Nsf Xylem Compr... 58 4e-007
gb|CD020175.1|CD020175 NXNV021F06 Nsf Xylem Normal wood Ver... 58 4e-007
gb|BX682803.1|BX682803 BX682803 Pinus pinaster differenciat... 58 4e-007
gb|CO366572.1|CO366572 RTK1_28_E01.g1_A029 Roots minus pota... 58 4e-007
gb|DR094912.1|DR094912 STRR1_17_C09.g1_A033 Stem Response R... 58 4e-007
gb|DR162670.1|DR162670 RTFE1_19_A09.g1_A029 Roots minus iro... 58 4e-007
gb|DR164081.1|DR164081 RTFE1_46_E06.g1_A029 Roots minus iro... 58 4e-007
gb|AW225647.1|AW225647 ST69E02 Pine TriplEx shoot tip libra... 56 2e-006
gb|BX249856.1|BX249856 BX249856 Pinus pinaster differenciat... 56 2e-006
gb|CF665613.1|CF665613 RTCNT1_17_D05.b1_A029 Root control P... 56 2e-006
gb|AW497846.1|AW497846 PC02B01 Pine TriplEx pollen cone lib... 54 6e-006
gb|BX253502.1|BX253502 BX253502 Pinus pinaster differenciat... 54 6e-006
gb|BG040465.1|BG040465 NXSI_108_E07_F NXSI (Nsf Xylem Side ... 54 6e-006
gb|CF394448.1|CF394448 RTDS2_5_G10.g1_A021 Drought-stressed... 54 6e-006
gb|CF667344.1|CF667344 RTCNT1_29_D03.g1_A029 Root control P... 54 6e-006
gb|BX678959.1|BX678959 BX678959 RS Pinus pinaster cDNA clon... 54 6e-006
gb|BX681998.1|BX681998 BX681998 RS Pinus pinaster cDNA clon... 54 6e-006
gb|DR015280.1|DR015280 STRS1_2_C04.g1_A034 Shoot tip pitch ... 54 6e-006
gb|BE582334.1|BE582334 NXCI_032_B09_F NXCI (Nsf Xylem Compr... 52 2e-005
gb|BF221192.1|BF221192 NXCI_164_G03_F NXCI (Nsf Xylem Compr... 52 2e-005
gb|CD016010.1|CD016010 NXCI_009_B03_F NXCI (Nsf Xylem Compr... 52 2e-005
gb|CD017576.1|CD017576 NXCI_128_E03_F NXCI (Nsf Xylem Compr... 52 2e-005
gb|CD025225.1|CD025225 NXSI_027_A09_F NXSI (Nsf Xylem Side ... 52 2e-005
gb|CD023127.1|CD023127 NXPV_100_D02_F NXPV (Nsf Xylem Plani... 50 1e-004
gb|DR081159.1|DR081159 RTFEPL1_27_G08.g1_A029 Roots plus ad... 50 1e-004
gb|DR095066.1|DR095066 STRR1_18_C07.g1_A033 Stem Response R... 50 1e-004
gb|AW056811.1|AW056811 ST56E04 Pine TriplEx shoot tip libra... 48 4e-004
gb|BQ699026.1|BQ699026 NXRV118_E06_F NXRV (Nsf Xylem Root w... 48 4e-004
gb|CD020849.1|CD020849 NXNV_091_F08_F Nsf Xylem Normal wood... 48 4e-004
gb|CD025607.1|CD025607 NXSI_065_E04_F NXSI (Nsf Xylem Side ... 48 4e-004
gb|CF397742.1|CF397742 RTDS3_1_B12.g1_A022 Drought-stressed... 48 4e-004
gb|CF475830.1|CF475830 RTWW2_15_H08.g1_A021 Well-watered lo... 48 4e-004
gb|CO167732.1|CO167732 FLD1_70_G04.g1_A029 Root flooded Pin... 48 4e-004
gb|CV032911.1|CV032911 RTNACL1_19_C05.b1_A029 Roots plus ad... 48 4e-004
gb|DR020882.1|DR020882 STRS1_39_H09.g1_A034 Shoot tip pitch... 48 4e-004
gb|DR071731.1|DR071731 RTDK1_21_F06.g1_A029 Roots, dark Pin... 48 4e-004
gb|DR078363.1|DR078363 RTFEPL1_3_D12.g1_A029 Roots plus add... 48 4e-004
gb|DR110185.1|DR110185 RTS1_9_A03.g1_A029 Roots minus sulfu... 48 4e-004
gb|BE123606.1|BE123606 NXNV_146_C08_F Nsf Xylem Normal wood... 46 0.002
gb|CD016750.1|CD016750 NXCI_055_G12_F NXCI (Nsf Xylem Compr... 46 0.002
gb|CD017183.1|CD017183 NXCI_100_G03_F NXCI (Nsf Xylem Compr... 46 0.002
gb|CR392731.1|CR392731 CR392731 RN Pinus pinaster cDNA clon... 46 0.002
gb|CF663856.1|CF663856 RTCNT1_5_C09.g1_A029 Root control Pi... 44 0.006
gb|DR050581.1|DR050581 RTBOR1_24_A06.g1_A029 Roots plus add... 44 0.006
gb|DR161640.1|DR161640 RTFE1_13_B10.b1_A029 Roots minus iro... 44 0.006
gb|AA556541.1|AA556541 396 Loblolly pine C Pinus taeda cDNA... 42 0.024
gb|AA557014.1|AA557014 856 Loblolly pine N Pinus taeda cDNA... 40 0.093
gb|CF473534.1|CF473534 RTWW2_3_D11.b2_A021 Well-watered lob... 40 0.093
gb|DR120606.1|DR120606 RTMG1_30_G02.g1_A029 Roots minus mag... 40 0.093
gb|DR160428.1|DR160428 RTFE1_5_H11.g1_A029 Roots minus iron... 40 0.093
gb|BF609777.1|BF609777 NXSI_050_C08_F NXSI (Nsf Xylem Side ... 38 0.37
gb|BG832428.1|BG832428 NXPV_072_E05_F NXPV (Nsf Xylem Plani... 38 0.37
gb|BI076894.1|BI076894 NXPV_082_D02_F NXPV (Nsf Xylem Plani... 38 0.37
gb|BQ702210.1|BQ702210 NXSI_126_B08_F NXSI (Nsf Xylem Side ... 38 0.37
>gb|BX249081.1|BX249081 BX249081 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP015D01 similar to S ADENOSYLMETHIONINE
SYNTHETASE, mRNA sequence
Length = 680
Score = 192 bits (97), Expect = 1e-047
Identities = 172/197 (87%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 77 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 136
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 137 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 196
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 197 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 256
Query: 382 gtcgactacgagaagat 398
|||||||| ||| ||||
Sbjct: 257 gtcgactatgagcagat 273
>gb|BX250117.1|BX250117 BX250117 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP032F06 similar to S ADENOSYLMETHIONINE
SYNTHETASE, mRNA sequence
Length = 596
Score = 192 bits (97), Expect = 1e-047
Identities = 172/197 (87%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 66 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 125
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 126 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 185
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 186 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 245
Query: 382 gtcgactacgagaagat 398
|||||||| ||| ||||
Sbjct: 246 gtcgactatgagcagat 262
>gb|BX250380.1|BX250380 BX250380 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP036C02 similar to S ADENOSYLMETHIONINE
SYNTHETASE, mRNA sequence
Length = 601
Score = 192 bits (97), Expect = 1e-047
Identities = 172/197 (87%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 70 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 129
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 130 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 189
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 190 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 249
Query: 382 gtcgactacgagaagat 398
|||||||| ||| ||||
Sbjct: 250 gtcgactatgagcagat 266
>gb|BX252881.1|BX252881 BX252881 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP074C10 similar to S ADENOSYLMETHIONINE
SYNTHETASE, mRNA sequence
Length = 497
Score = 192 bits (97), Expect = 1e-047
Identities = 172/197 (87%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 70 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 129
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 130 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 189
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 190 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 249
Query: 382 gtcgactacgagaagat 398
|||||||| ||| ||||
Sbjct: 250 gtcgactatgagcagat 266
>gb|BX255705.1|BX255705 BX255705 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP008G11 similar to S ADENOSYLMETHIONINE
SYNTHETASE, mRNA sequence
Length = 420
Score = 192 bits (97), Expect = 1e-047
Identities = 172/197 (87%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 75 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 134
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 135 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 194
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 195 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 254
Query: 382 gtcgactacgagaagat 398
|||||||| ||| ||||
Sbjct: 255 gtcgactatgagcagat 271
>gb|BQ696322.1|BQ696322 NXPV_040_A07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_040_A07 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 550
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 80 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 139
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 140 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 199
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 200 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 259
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 260 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 319
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 320 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 379
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 380 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 434
>gb|CO367246.1|CO367246 RTK1_33_D07.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_33_D07_A029 3', mRNA sequence
Length = 791
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Minus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 721 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 662
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 661 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 602
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 601 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 542
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 541 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 482
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 481 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 422
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 421 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 367
>gb|CO367561.1|CO367561 RTK1_35_C07.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_35_C07_A029 3', mRNA sequence
Length = 803
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Minus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 733 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 674
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 673 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 614
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 613 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 554
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 553 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 494
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 493 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 434
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 433 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 379
>gb|CX647567.1|CX647567 COLD1_17_G11.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_17_G11_A029 5', mRNA sequence
Length = 749
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 60 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 119
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 120 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 179
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 180 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 239
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 240 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 299
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 300 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 359
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 360 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 414
>gb|DR016235.1|DR016235 STRS1_8_F09.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_8_F09_A034 5', mRNA sequence
Length = 848
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 129 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 188
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 189 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 248
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 249 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 308
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 309 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 368
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 369 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 428
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 429 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 483
>gb|DR022233.1|DR022233 STRS1_49_E10.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_49_E10_A034 5', mRNA sequence
Length = 611
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 52 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 111
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 112 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 171
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 172 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 231
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 232 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 291
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 292 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 351
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 352 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 406
>gb|DR080053.1|DR080053 RTFEPL1_19_G11.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_19_G11_A029 5', mRNA sequence
Length = 712
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 52 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 111
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 112 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 171
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 172 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 231
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 232 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 291
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 292 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 351
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 352 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 406
>gb|DR094426.1|DR094426 STRR1_14_B08.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_14_B08_A033 5', mRNA sequence
Length = 831
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 40 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 99
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 100 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 159
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 160 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 219
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 220 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 279
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 280 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 339
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 340 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 394
>gb|DR160907.1|DR160907 RTFE1_8_E10.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_8_E10_A029 5', mRNA sequence
Length = 909
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 47 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 106
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 107 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 166
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 167 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 226
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 227 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 286
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 287 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 346
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 347 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 401
>gb|DR385474.1|DR385474 RTHG1_8_H02.g1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_8_H02_A029 5', mRNA sequence
Length = 908
Score = 188 bits (95), Expect = 2e-046
Identities = 290/355 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 55 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 114
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 115 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 174
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 175 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 234
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 235 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 294
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 295 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 354
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| | || ||||||||||| ||||
Sbjct: 355 attgcccagggtgttcatgggcactttaccaagaggcctgaggagattggggctg 409
>gb|AI725188.1|AI725188 1087 PtIFG2 Pinus taeda cDNA clone 9113r, mRNA sequence
Length = 759
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 84 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 143
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 144 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 203
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 204 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 263
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 264 gttgactatgagcagat 280
>gb|BE451964.1|BE451964 NXCI_006_H02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_006_H02 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 566
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 64 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 123
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 124 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 183
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 184 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 243
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 244 gttgactatgagcagat 260
>gb|BE496269.1|BE496269 NXCI_022_A07_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_022_A07 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 577
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 68 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 127
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 128 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 187
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 188 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 247
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 248 gttgactatgagcagat 264
>gb|BE520138.1|BE520138 NXCI_027_F04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_027_F04 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 453
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 61 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 120
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 121 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 180
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 181 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 240
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 241 gttgactatgagcagat 257
>gb|BE657154.1|BE657154 NXCI_064_F10_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_064_F10 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 391
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 68 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 127
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 128 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 187
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 188 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 247
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 248 gttgactatgagcagat 264
>gb|BE810239.1|BE810239 NXCI_061_H09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_061_H09 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 374
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 37 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 96
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 97 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 156
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 157 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 216
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 217 gttgactatgagcagat 233
>gb|BF186019.1|BF186019 NXCI_132_B09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_132_B09 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 520
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 60 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 119
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 120 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 179
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 180 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 239
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 240 gttgactatgagcagat 256
>gb|BG040251.1|BG040251 NXSI_110_C01_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_C01 5' similar to Arabidopsis thaliana
sequence At3g17390 s-adenosylmethionine synthetase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 621
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 135 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 194
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 195 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 254
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 255 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 314
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 315 gttgactatgagcagat 331
>gb|BG275512.1|BG275512 NXSI_139_F08_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_139_F08 5' similar to Arabidopsis thaliana
sequence At3g17390 s-adenosylmethionine synthetase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 532
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 73 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 132
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 133 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 192
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 193 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 252
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 253 gttgactatgagcagat 269
>gb|BG318162.1|BG318162 NXPV_011_B12_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_011_B12 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 549
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 64 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 123
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 124 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 183
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 184 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 243
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 244 gttgactatgagcagat 260
>gb|BG318683.1|BG318683 NXPV_017_G07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_017_G07 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 516
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 64 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 123
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 124 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 183
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 184 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 243
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 244 gttgactatgagcagat 260
>gb|BG319269.1|BG319269 NXPV_019_G11_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_019_G11 5' similar to Arabidopsis
thaliana sequence At3g17390 s-adenosylmethionine
synthetase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 450
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 81 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 140
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 141 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 200
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 201 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 260
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 261 gttgactatgagcagat 277
>gb|BQ634158.1|BQ634158 NXRV064_E01_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV064_E01 5' similar to Arabidopsis thaliana
sequence At3g17390 s-adenosylmethionine synthetase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 703
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 73 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 132
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 133 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 192
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 193 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 252
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 253 gttgactatgagcagat 269
>gb|BQ654428.1|BQ654428 NXRV080_B09_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV080_B09 5' similar to Arabidopsis thaliana
sequence At3g17390 s-adenosylmethionine synthetase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 544
Score = 184 bits (93), Expect = 3e-045
Identities = 289/355 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 79 accttcctcttcacatctgagtctgtgaacgagggacacccagacaaactgtgtgaccaa 138
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| ||| |||| || ||||| | ||||||||||||||||||| || |||
Sbjct: 139 atctctgatgcagttttggatgcatgcctcacccaggaccctgacagcaaggtagcatgc 198
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 199 gagacttgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 258
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|||||||| ||| |||| || | |||| ||| | | ||||| ||| | || |||||
Sbjct: 259 gtcgactatgagcagatcgttcgcaagacctgcagggagattggcttcatttctgacgat 318
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || || || ||||| |||||||| || || | ||||| || |||||| |||||||
Sbjct: 319 gtgggtctcgatgctgatcactgcaaagtcctggttaacatcgaacagcagagccctgat 378
Query: 502 attgctcagggtgtgcacgggcacttcaccaagcgccccgaggagattggagctg 556
||||| |||||||| || |||||||| |||||| || ||||||||||| ||||
Sbjct: 379 attgcccagggtgttcatgggcactttaccaaganncctgaggagattggggctg 433
>gb|BQ655176.1|BQ655176 NXRV091_B03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV091_B03 5' similar to Arabidopsis thaliana
sequence At3g17390 s-adenosylmethionine synthetase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 756
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 76 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 135
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 136 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 195
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 196 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 255
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 256 gttgactatgagcagat 272
>gb|BQ699871.1|BQ699871 NXRV122_F09_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV122_F09 5' similar to Arabidopsis thaliana
sequence At3g17390 s-adenosylmethionine synthetase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 740
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 71 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 130
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 131 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 190
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 191 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 250
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 251 gttgactatgagcagat 267
>gb|BQ701746.1|BQ701746 NXSI_120_B05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_120_B05 5' similar to Arabidopsis thaliana
sequence At3g17390 s-adenosylmethionine synthetase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 544
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 64 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 123
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 124 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 183
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 184 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 243
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 244 gttgactatgagcagat 260
>gb|BQ701982.1|BQ701982 NXSI_122_H08_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_122_H08 5' similar to Arabidopsis thaliana
sequence At3g17390 s-adenosylmethionine synthetase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 422
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 64 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 123
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 124 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 183
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 184 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 243
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 244 gttgactatgagcagat 260
>gb|BQ702539.1|BQ702539 NXSI_129_G05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_129_G05 5' similar to Arabidopsis thaliana
sequence At3g17390 s-adenosylmethionine synthetase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 496
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 65 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 124
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 125 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 184
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 185 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 244
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 245 gttgactatgagcagat 261
>gb|CF477832.1|CF477832 RTWW3_13_A10.b1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_13_A10_A022 3', mRNA sequence
Length = 586
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Minus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 522 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 463
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 462 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 403
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 402 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 343
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 342 gttgactatgagcagat 326
>gb|CO159741.1|CO159741 FLD1_15_C02.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_15_C02_A029 5', mRNA sequence
Length = 696
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 61 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 120
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 121 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 180
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 181 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 240
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 241 gttgactatgagcagat 257
>gb|CO197225.1|CO197225 GEO1_4_E11.g1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_4_E11_A029 5', mRNA sequence
Length = 764
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 52 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 111
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 112 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 171
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 172 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 231
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 232 gttgactatgagcagat 248
>gb|CV032792.1|CV032792 RTNACL1_18_H05.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_18_H05_A029 3', mRNA sequence
Length = 828
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Minus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 756 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 697
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 696 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 637
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 636 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 577
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 576 gttgactatgagcagat 560
>gb|DR012531.1|DR012531 HEAT1_13_A06.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_13_A06_A029 5', mRNA sequence
Length = 679
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 73 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 132
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 133 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 192
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 193 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 252
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 253 gttgactatgagcagat 269
>gb|DR020681.1|DR020681 STRS1_38_C12.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_38_C12_A034 5', mRNA sequence
Length = 700
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 46 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 105
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 106 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 165
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 166 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 225
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 226 gttgactatgagcagat 242
>gb|DR021557.1|DR021557 STRS1_45_B03.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_45_B03_A034 5', mRNA sequence
Length = 711
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 55 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 114
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 115 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 174
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 175 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 234
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 235 gttgactatgagcagat 251
>gb|DR024469.1|DR024469 STRS1_65_E02.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_65_E02_A034 3', mRNA sequence
Length = 849
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Minus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 795 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 736
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 735 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 676
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 675 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 616
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 615 gttgactatgagcagat 599
>gb|DR050460.1|DR050460 RTBOR1_23_D10.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_23_D10_A029 5', mRNA sequence
Length = 816
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 25 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 84
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 85 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 144
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 145 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 204
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 205 gttgactatgagcagat 221
>gb|DR054286.1|DR054286 RTCA1_16_A04.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_16_A04_A029 5', mRNA sequence
Length = 610
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 12 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 71
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 72 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 131
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 132 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 191
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 192 gttgactatgagcagat 208
>gb|DR070298.1|DR070298 RTDK1_12_A10.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_12_A10_A029 5', mRNA sequence
Length = 784
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 75 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 134
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 135 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 194
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 195 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 254
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 255 gttgactatgagcagat 271
>gb|DR071258.1|DR071258 RTDK1_18_E11.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_18_E11_A029 5', mRNA sequence
Length = 630
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 39 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 98
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 99 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 158
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 159 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 218
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 219 gttgactatgagcagat 235
>gb|DR089504.1|DR089504 RTAL1_9_D02.b1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_9_D02_A029 3', mRNA sequence
Length = 775
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Minus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 670 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 611
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 610 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 551
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 550 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 491
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 490 gttgactatgagcagat 474
>gb|DR091075.1|DR091075 RTAL1_19_F03.b1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_19_F03_A029 3', mRNA sequence
Length = 729
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Minus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 642 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 583
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 582 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 523
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 522 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 463
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 462 gttgactatgagcagat 446
>gb|DR091208.1|DR091208 RTAL1_20_C04.b1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_20_C04_A029 3', mRNA sequence
Length = 802
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Minus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 725 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 666
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 665 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 606
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 605 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 546
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 545 gttgactatgagcagat 529
>gb|DR096860.1|DR096860 STRR1_30_G09.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_30_G09_A033 5', mRNA sequence
Length = 819
Score = 184 bits (93), Expect = 3e-045
Identities = 171/197 (86%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
|||||||||||||| || ||||| ||||||||||||||||| |||||||| || ||||||
Sbjct: 17 accttcctcttcacatccgagtctgtgaacgagggacacccagacaagctgtgtgaccag 76
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| ||||| || |||| || |||||| | ||||||||||||||||||| || |||
Sbjct: 77 atctctgatgcagtgttggatgcatgccttacccaggaccctgacagcaaggtagcatgc 136
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||||||||| || || |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 137 gagacctgcactaaaacgaacatggtcatggtttttggtgaaatcaccaccaaggccaat 196
Query: 382 gtcgactacgagaagat 398
|| ||||| ||| ||||
Sbjct: 197 gttgactatgagcagat 213
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 74,465
Number of Sequences: 355925
Number of extensions: 74465
Number of successful extensions: 24417
Number of sequences better than 0.5: 459
Number of HSP's better than 0.5 without gapping: 453
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 23379
Number of HSP's gapped (non-prelim): 872
length of query: 556
length of database: 217,277,237
effective HSP length: 19
effective length of query: 537
effective length of database: 210,514,662
effective search space: 113046373494
effective search space used: 113046373494
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)