BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2419405.2.4
         (582 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|DR024533.1|DR024533  STRS1_65_D09.g1_A034 Shoot tip pitch...    38   0.39 

>gb|DR024533.1|DR024533 STRS1_65_D09.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
           cDNA clone STRS1_65_D09_A034 5', mRNA sequence
          Length = 326

 Score = 38.2 bits (19), Expect = 0.39
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 211 cccatgctgcatatgcagcaatacaat 237
           |||||||||||| |||||||| |||||
Sbjct: 255 cccatgctgcatctgcagcaagacaat 281



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 61,725
Number of Sequences: 355925
Number of extensions: 61725
Number of successful extensions: 14841
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14840
Number of HSP's gapped (non-prelim): 1
length of query: 582
length of database: 217,277,237
effective HSP length: 19
effective length of query: 563
effective length of database: 210,514,662
effective search space: 118519754706
effective search space used: 118519754706
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)