BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419405.2.1
(1293 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW011587.1|AW011587 ST22E11 Pine TriplEx shoot tip libra... 46 0.004
gb|AW870062.1|AW870062 NXNV_123_F07_F Nsf Xylem Normal wood... 40 0.22
gb|BQ291059.1|BQ291059 NXRV055_B07_F NXRV (Nsf Xylem Root w... 40 0.22
gb|CF472202.1|CF472202 RTDS1_5_H06.b1_A015 Drought-stressed... 40 0.22
gb|CV034468.1|CV034468 RTNACL1_9_D04.b1_A029 Roots plus add... 40 0.22
gb|CV034527.1|CV034527 RTNACL1_9_D04.g1_A029 Roots plus add... 40 0.22
gb|DR058207.1|DR058207 RTNIT1_10_A04.g1_A029 Roots minus ni... 40 0.22
gb|DR058594.1|DR058594 RTNIT1_12_F06.g1_A029 Roots minus ni... 40 0.22
gb|DR163166.1|DR163166 RTFE1_41_G07.b1_A029 Roots minus iro... 40 0.22
gb|DR384641.1|DR384641 RTHG1_3_C10.g1_A029 Roots plus added... 40 0.22
gb|DR386395.1|DR386395 RTHG1_15_A01.b1_A029 Roots plus adde... 40 0.22
gb|DR386407.1|DR386407 RTHG1_15_B02.b1_A029 Roots plus adde... 40 0.22
>gb|AW011587.1|AW011587 ST22E11 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST22E11, mRNA sequence
Length = 596
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1205 tatcatcatcatcttcttcttct 1227
|||||||||||||||||||||||
Sbjct: 428 tatcatcatcatcttcttcttct 406
>gb|AW870062.1|AW870062 NXNV_123_F07_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_123_F07 5', mRNA sequence
Length = 509
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 84 tcatcatcatcttcttcttc 65
>gb|BQ291059.1|BQ291059 NXRV055_B07_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV055_B07 5', mRNA sequence
Length = 552
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1208 catcatcatcttcttcttct 1227
||||||||||||||||||||
Sbjct: 524 catcatcatcttcttcttct 505
>gb|CF472202.1|CF472202 RTDS1_5_H06.b1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_5_H06_A015 3', mRNA sequence
Length = 710
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 313 tcatcatcatcttcttcttc 294
>gb|CV034468.1|CV034468 RTNACL1_9_D04.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_9_D04_A029 3', mRNA sequence
Length = 703
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 37 tcatcatcatcttcttcttc 56
>gb|CV034527.1|CV034527 RTNACL1_9_D04.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_9_D04_A029 5', mRNA sequence
Length = 774
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 378 tcatcatcatcttcttcttc 397
>gb|DR058207.1|DR058207 RTNIT1_10_A04.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_10_A04_A029 5', mRNA sequence
Length = 723
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 442 tcatcatcatcttcttcttc 461
>gb|DR058594.1|DR058594 RTNIT1_12_F06.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_12_F06_A029 5', mRNA sequence
Length = 751
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 470 tcatcatcatcttcttcttc 489
>gb|DR163166.1|DR163166 RTFE1_41_G07.b1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_41_G07_A029 3', mRNA sequence
Length = 895
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 418 tcatcatcatcttcttcttc 399
>gb|DR384641.1|DR384641 RTHG1_3_C10.g1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_3_C10_A029 5', mRNA sequence
Length = 518
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 373 tcatcatcatcttcttcttc 392
>gb|DR386395.1|DR386395 RTHG1_15_A01.b1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_15_A01_A029 3', mRNA sequence
Length = 706
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 81 tcatcatcatcttcttcttc 100
>gb|DR386407.1|DR386407 RTHG1_15_B02.b1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_15_B02_A029 3', mRNA sequence
Length = 648
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1207 tcatcatcatcttcttcttc 1226
||||||||||||||||||||
Sbjct: 38 tcatcatcatcttcttcttc 57
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 172,615
Number of Sequences: 355925
Number of extensions: 172615
Number of successful extensions: 51772
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51744
Number of HSP's gapped (non-prelim): 28
length of query: 1293
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1274
effective length of database: 210,514,662
effective search space: 268195679388
effective search space used: 268195679388
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)