BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2418946.2.1
(690 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AI812992.1|AI812992 2E10 Pine Lambda Zap Xylem library P... 42 0.030
gb|BF049746.1|BF049746 NXCI_106_F09_F NXCI (Nsf Xylem Compr... 42 0.030
gb|BF221028.1|BF221028 NXCI_162_C02_F NXCI (Nsf Xylem Compr... 42 0.030
gb|CF394902.1|CF394902 RTDS2_8_B01.b1_A021 Drought-stressed... 40 0.12
gb|BX678600.1|BX678600 BX678600 RS Pinus pinaster cDNA clon... 38 0.46
gb|BX678794.1|BX678794 BX678794 RS Pinus pinaster cDNA clon... 38 0.46
gb|CO158939.1|CO158939 FLD1_10_F07.b1_A029 Root flooded Pin... 38 0.46
gb|DR071603.1|DR071603 RTDK1_21_A05.b1_A029 Roots, dark Pin... 38 0.46
gb|DR386010.1|DR386010 RTHG1_12_G05.b1_A029 Roots plus adde... 38 0.46
gb|DR386081.1|DR386081 RTHG1_12_G05.g1_A029 Roots plus adde... 38 0.46
>gb|AI812992.1|AI812992 2E10 Pine Lambda Zap Xylem library Pinus taeda cDNA, mRNA sequence
Length = 675
Score = 42.1 bits (21), Expect = 0.030
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 79 cttgctttcatgcccactggatggg 103
||||| |||||||||||||||||||
Sbjct: 424 cttgcattcatgcccactggatggg 448
>gb|BF049746.1|BF049746 NXCI_106_F09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_106_F09 5' similar to Arabidopsis
thaliana sequence At2g31960 glucan synthase like protein
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 213
Score = 42.1 bits (21), Expect = 0.030
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 79 cttgctttcatgcccactggatggg 103
||||| |||||||||||||||||||
Sbjct: 1 cttgcattcatgcccactggatggg 25
>gb|BF221028.1|BF221028 NXCI_162_C02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_162_C02 5' similar to Arabidopsis
thaliana sequence At2g31960 glucan synthase like protein
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 381
Score = 42.1 bits (21), Expect = 0.030
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 79 cttgctttcatgcccactggatggg 103
||||| |||||||||||||||||||
Sbjct: 1 cttgcattcatgcccactggatggg 25
>gb|CF394902.1|CF394902 RTDS2_8_B01.b1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_8_B01_A021 3', mRNA sequence
Length = 559
Score = 40.1 bits (20), Expect = 0.12
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 74 gcatccttgctttcatgcccactggatggggt 105
|||||||||| ||||| || ||||||||||||
Sbjct: 19 gcatccttgcattcataccaactggatggggt 50
>gb|BX678600.1|BX678600 BX678600 RS Pinus pinaster cDNA clone RS11G06, mRNA sequence
Length = 551
Score = 38.2 bits (19), Expect = 0.46
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 277 ttcaaccaggcgttcagcagagg 299
||||||||||||||||| |||||
Sbjct: 306 ttcaaccaggcgttcagtagagg 328
>gb|BX678794.1|BX678794 BX678794 RS Pinus pinaster cDNA clone RS15C01, mRNA sequence
Length = 488
Score = 38.2 bits (19), Expect = 0.46
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 277 ttcaaccaggcgttcagcagagg 299
||||||||||||||||| |||||
Sbjct: 314 ttcaaccaggcgttcagtagagg 336
>gb|CO158939.1|CO158939 FLD1_10_F07.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_10_F07_A029 3', mRNA sequence
Length = 760
Score = 38.2 bits (19), Expect = 0.46
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 277 ttcaaccaggcgttcagcagagg 299
||||||||||||||||| |||||
Sbjct: 211 ttcaaccaggcgttcagtagagg 233
>gb|DR071603.1|DR071603 RTDK1_21_A05.b1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_21_A05_A029 3', mRNA sequence
Length = 769
Score = 38.2 bits (19), Expect = 0.46
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 277 ttcaaccaggcgttcagcagagg 299
||||||||||||||||| |||||
Sbjct: 343 ttcaaccaggcgttcagtagagg 365
>gb|DR386010.1|DR386010 RTHG1_12_G05.b1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_12_G05_A029 3', mRNA sequence
Length = 806
Score = 38.2 bits (19), Expect = 0.46
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 277 ttcaaccaggcgttcagcagagg 299
||||||||||||||||| |||||
Sbjct: 196 ttcaaccaggcgttcagtagagg 218
>gb|DR386081.1|DR386081 RTHG1_12_G05.g1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_12_G05_A029 5', mRNA sequence
Length = 804
Score = 38.2 bits (19), Expect = 0.46
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 277 ttcaaccaggcgttcagcagagg 299
||||||||||||||||| |||||
Sbjct: 340 ttcaaccaggcgttcagtagagg 362
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 80,064
Number of Sequences: 355925
Number of extensions: 80064
Number of successful extensions: 31511
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31498
Number of HSP's gapped (non-prelim): 13
length of query: 690
length of database: 217,277,237
effective HSP length: 19
effective length of query: 671
effective length of database: 210,514,662
effective search space: 141255338202
effective search space used: 141255338202
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)