BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2405341.2.2
(1164 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX248859.1|BX248859 BX248859 Pinus pinaster differenciat... 64 1e-008
gb|DR686550.1|DR686550 EST1076628 Normalized pine embryo li... 58 8e-007
gb|DT633242.1|DT633242 EST1148173 Normalized pine embryo li... 58 8e-007
dbj|BD267268.1| Compositions isolated from plant cells and ... 58 8e-007
dbj|BD267190.1| Compositions isolated from plant cells and ... 50 2e-004
gb|CO176663.1|CO176663 NDL1_63_A06.g1_A029 Needles control ... 48 8e-004
gb|CV034109.1|CV034109 RTNACL1_38_E12.g1_A029 Roots plus ad... 48 8e-004
gb|AW437900.1|AW437900 ST78A08 Pine TriplEx shoot tip libra... 44 0.013
gb|BX252468.1|BX252468 BX252468 Pinus pinaster differenciat... 44 0.013
gb|BX252982.1|BX252982 BX252982 Pinus pinaster differenciat... 44 0.013
gb|CF664997.1|CF664997 RTCNT1_13_E12.b1_A029 Root control P... 44 0.013
gb|CO174519.1|CO174519 NDL1_44_B09.g1_A029 Needles control ... 44 0.013
gb|CX651434.1|CX651434 COLD1_52_H06.b1_A029 Root cold Pinus... 44 0.013
gb|DR078364.1|DR078364 RTFEPL1_3_E03.g1_A029 Roots plus add... 44 0.013
gb|DN609148.1|DN609148 EST962198 Subtracted pine embryo lib... 42 0.050
gb|DN610243.1|DN610243 EST963293 Subtracted pine embryo lib... 42 0.050
gb|DR100269.1|DR100269 STRR1_63_A01.b1_A033 Stem Response R... 42 0.050
gb|DR179438.1|DR179438 RTMNUT1_22_D07.b2_A029 Roots minus m... 42 0.050
gb|DR691332.1|DR691332 EST1081419 Normalized pine embryo li... 42 0.050
gb|DT628418.1|DT628418 EST1157167 Subtracted pine embryo li... 42 0.050
gb|AW290318.1|AW290318 NXNV018F12F Nsf Xylem Normal wood Ve... 40 0.20
gb|BE582268.1|BE582268 NXCI_031_C02_F NXCI (Nsf Xylem Compr... 40 0.20
gb|BG317789.1|BG317789 NXPV_005_G01_F NXPV (Nsf Xylem Plani... 40 0.20
gb|BG318425.1|BG318425 NXPV_013_E05_F NXPV (Nsf Xylem Plani... 40 0.20
gb|BG832875.1|BG832875 NXPV_081_G09_F NXPV (Nsf Xylem Plani... 40 0.20
gb|BI077164.1|BI077164 NXPV_089_F08_F NXPV (Nsf Xylem Plani... 40 0.20
gb|BI643975.1|BI643975 NXPV_133_E01_F NXPV (Nsf Xylem Plani... 40 0.20
gb|BQ696768.1|BQ696768 NXPV_045_A07_F NXPV (Nsf Xylem Plani... 40 0.20
gb|BQ696914.1|BQ696914 NXPV_046_G10_F NXPV (Nsf Xylem Plani... 40 0.20
gb|BQ700950.1|BQ700950 NXRV113_F02_F NXRV (Nsf Xylem Root w... 40 0.20
gb|CD025834.1|CD025834 NXSI_083_A03_F NXSI (Nsf Xylem Side ... 40 0.20
gb|CD027008.1|CD027008 NXNV018F12 Nsf Xylem Normal wood Ver... 40 0.20
gb|CF471819.1|CF471819 RTDS1_6_A09.g1_A015 Drought-stressed... 40 0.20
gb|CF477208.1|CF477208 RTWW3_6_G05.g1_A022 Well-watered lob... 40 0.20
gb|CF664882.1|CF664882 RTCNT1_12_B09.g1_A029 Root control P... 40 0.20
gb|CF667809.1|CF667809 RTCNT1_32_D10.g1_A029 Root control P... 40 0.20
gb|CF668841.1|CF668841 RTCNT1_39_B05.b1_A029 Root control P... 40 0.20
gb|BX682777.1|BX682777 BX682777 Pinus pinaster differenciat... 40 0.20
gb|DN445333.1|DN445333 EST941132 Sequencing ESTs from loblo... 40 0.20
gb|DR161692.1|DR161692 RTFE1_13_G12.b1_A029 Roots minus iro... 40 0.20
gb|DR178599.1|DR178599 RTMNUT1_12_F08.g1_A029 Roots minus m... 40 0.20
gb|DT626195.1|DT626195 EST1158119 Sequencing ESTs from lobl... 40 0.20
dbj|BD267259.1| Compositions isolated from plant cells and ... 40 0.20
>gb|BX248859.1|BX248859 BX248859 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP001H07, mRNA sequence
Length = 650
Score = 63.9 bits (32), Expect = 1e-008
Identities = 230/296 (77%)
Strand = Plus / Plus
Query: 389 cctcgaataatacatcgtgatatcaagtcgagcaacatcttgcttgacggcagttttgag 448
||||| || ||||||||||||||||| || |||||||| ||||||||| | | || ||
Sbjct: 16 cctcgtatcatacatcgtgatatcaaatccagcaacatattgcttgacaggaacttggaa 75
Query: 449 gcccgcgtatcagactttggacttgcaaagcttttagaggacgaagaatcccatatcact 508
||| ||| | || ||||| ||||| ||||| || |||||| |||| || || |||||
Sbjct: 76 tcccatgtagctgattttgggcttgccaagctgttggaggaccaagagtcacacatcaca 135
Query: 509 acaatagttgcaggaacatttggttatcttgcgccagagtatatgcagtttggcagagcc 568
|| || ||||| ||||||||| |||||| || ||||| || ||||| |||||||||
Sbjct: 136 accattgttgctggaacatttttttatctggctccagaatacatgcacagtggcagagca 195
Query: 569 accgagaagaccgatgtctacagttttggggttctggtacttgaaatactcagcggaaag 628
|| || ||| | ||||| || |||||||| ||||| | |||||| | | || ||||||
Sbjct: 196 acagaaaaggctgatgtatatagttttggagttcttctgcttgaacttttgagtggaaag 255
Query: 629 cgacctaccgatgcatccttcattgagaagggattaaacattgttggatggttaaa 684
|| || || ||| || | ||||| ||||| ||| | || ||||||||||||||||
Sbjct: 256 cggccaactgattcagcattcatcgagaaaggactgaatgttgttggatggttaaa 311
>gb|DR686550.1|DR686550 EST1076628 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABH27 3' end, mRNA sequence
Length = 739
Score = 58.0 bits (29), Expect = 8e-007
Identities = 59/69 (85%)
Strand = Plus / Plus
Query: 368 tacttgcatcacgattgttcgcctcgaataatacatcgtgatatcaagtcgagcaacatc 427
|||||||| || || || || ||||| || ||||||||||||||||| || ||||||||
Sbjct: 607 tacttgcaccatgactgctcccctcgtatcatacatcgtgatatcaaatccagcaacata 666
Query: 428 ttgcttgac 436
|||||||||
Sbjct: 667 ttgcttgac 675
>gb|DT633242.1|DT633242 EST1148173 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMFS84 3' end, mRNA sequence
Length = 782
Score = 58.0 bits (29), Expect = 8e-007
Identities = 59/69 (85%)
Strand = Plus / Plus
Query: 368 tacttgcatcacgattgttcgcctcgaataatacatcgtgatatcaagtcgagcaacatc 427
|||||||| || || || || ||||| || ||||||||||||||||| || ||||||||
Sbjct: 635 tacttgcaccatgactgctcccctcgtatcatacatcgtgatatcaaatccagcaacata 694
Query: 428 ttgcttgac 436
|||||||||
Sbjct: 695 ttgcttgac 703
>dbj|BD267268.1| Compositions isolated from plant cells and utilization of the same
in modifying plant cell signal transduction
Length = 410
Score = 58.0 bits (29), Expect = 8e-007
Identities = 59/69 (85%)
Strand = Plus / Plus
Query: 368 tacttgcatcacgattgttcgcctcgaataatacatcgtgatatcaagtcgagcaacatc 427
|||||||| || || || || ||||| || ||||||||||||||||| || ||||||||
Sbjct: 312 tacttgcaccatgactgctcccctcgtatcatacatcgtgatatcaaatccagcaacata 371
Query: 428 ttgcttgac 436
|||||||||
Sbjct: 372 ttgcttgac 380
>dbj|BD267190.1| Compositions isolated from plant cells and utilization of the same
in modifying plant cell signal transduction
Length = 363
Score = 50.1 bits (25), Expect = 2e-004
Identities = 172/221 (77%)
Strand = Plus / Plus
Query: 464 tttggacttgcaaagcttttagaggacgaagaatcccatatcactacaatagttgcagga 523
||||| ||||| ||||| || |||||| | || || || ||||| || || ||||| |||
Sbjct: 31 tttgggcttgccaagctgttggaggaccaggagtcacacatcacaaccattgttgctgga 90
Query: 524 acatttggttatcttgcgccagagtatatgcagtttggcagagccaccgagaagaccgat 583
|||||||| ||||| || ||||| || ||||| ||||||||| || || ||| | |||
Sbjct: 91 acatttggctatctggctccagaatacatgcacagtggcagagcaacagaaaaggctgat 150
Query: 584 gtctacagttttggggttctggtacttgaaatactcagcggaaagcgacctaccgatgca 643
|| || |||||||| ||||| | |||||| | | || |||||||| || || ||| ||
Sbjct: 151 gtatatagttttggagttcttctgcttgaacttttgagtggaaagcggccaactgattca 210
Query: 644 tccttcattgagaagggattaaacattgttggatggttaaa 684
| ||||| ||||| ||| | || ||||||||||||||||
Sbjct: 211 gcattcatcgagaaaggactgaatgttgttggatggttaaa 251
>gb|CO176663.1|CO176663 NDL1_63_A06.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_63_A06_A029 5', mRNA sequence
Length = 754
Score = 48.1 bits (24), Expect = 8e-004
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 399 tacatcgtgatatcaagtcgagcaacat 426
||||||||||||||||||| ||||||||
Sbjct: 589 tacatcgtgatatcaagtcaagcaacat 616
>gb|CV034109.1|CV034109 RTNACL1_38_E12.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_38_E12_A029 5', mRNA sequence
Length = 714
Score = 48.1 bits (24), Expect = 8e-004
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 399 tacatcgtgatatcaagtcgagcaacat 426
||||||||||||||||||| ||||||||
Sbjct: 287 tacatcgtgatatcaagtcaagcaacat 314
>gb|AW437900.1|AW437900 ST78A08 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST78A08, mRNA sequence
Length = 570
Score = 44.1 bits (22), Expect = 0.013
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 455 gtatcagactttggacttgcaaagct 480
|||||||||||||| |||||||||||
Sbjct: 52 gtatcagactttggtcttgcaaagct 77
>gb|BX252468.1|BX252468 BX252468 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP065A03, mRNA sequence
Length = 530
Score = 44.1 bits (22), Expect = 0.013
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 580 cgatgtctacagttttggggttctggtacttgaa 613
|||||||||||||||||| ||| || ||||||||
Sbjct: 78 cgatgtctacagttttggtgttgtgttacttgaa 111
>gb|BX252982.1|BX252982 BX252982 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP076A03, mRNA sequence
Length = 646
Score = 44.1 bits (22), Expect = 0.013
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 455 gtatcagactttggacttgcaaagct 480
|||||||||||||| |||||||||||
Sbjct: 368 gtatcagactttggtcttgcaaagct 393
>gb|CF664997.1|CF664997 RTCNT1_13_E12.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_13_E12_A029 3', mRNA sequence
Length = 775
Score = 44.1 bits (22), Expect = 0.013
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 568 caccgagaagaccgatgtctacagttttgg 597
||||||||||| |||||| |||||||||||
Sbjct: 119 caccgagaagagcgatgtttacagttttgg 148
>gb|CO174519.1|CO174519 NDL1_44_B09.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_44_B09_A029 5', mRNA sequence
Length = 668
Score = 44.1 bits (22), Expect = 0.013
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 455 gtatcagactttggacttgcaaagct 480
|||||||||||||| |||||||||||
Sbjct: 605 gtatcagactttggtcttgcaaagct 630
>gb|CX651434.1|CX651434 COLD1_52_H06.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_52_H06_A029 3', mRNA sequence
Length = 689
Score = 44.1 bits (22), Expect = 0.013
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 455 gtatcagactttggacttgcaaagct 480
|||||||||||||| |||||||||||
Sbjct: 342 gtatcagactttggtcttgcaaagct 317
>gb|DR078364.1|DR078364 RTFEPL1_3_E03.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_3_E03_A029 5', mRNA sequence
Length = 611
Score = 44.1 bits (22), Expect = 0.013
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 455 gtatcagactttggacttgcaaagct 480
|||||||||||||| |||||||||||
Sbjct: 497 gtatcagactttggtcttgcaaagct 522
>gb|DN609148.1|DN609148 EST962198 Subtracted pine embryo library, Lib_B Pinus taeda cDNA
clone PSAA918, mRNA sequence
Length = 848
Score = 42.1 bits (21), Expect = 0.050
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggtt 601
|||||||||||||||||||||
Sbjct: 330 gatgtctacagttttggggtt 350
>gb|DN610243.1|DN610243 EST963293 Subtracted pine embryo library, Lib_B Pinus taeda cDNA
clone PSAAN38, mRNA sequence
Length = 839
Score = 42.1 bits (21), Expect = 0.050
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggtt 601
|||||||||||||||||||||
Sbjct: 330 gatgtctacagttttggggtt 350
>gb|DR100269.1|DR100269 STRR1_63_A01.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_63_A01_A033 3', mRNA sequence
Length = 797
Score = 42.1 bits (21), Expect = 0.050
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 518 gcaggaacatttggttatcttgcgccagagtat 550
||||| |||||||||||| |||| |||||||||
Sbjct: 769 gcaggtacatttggttatgttgctccagagtat 737
>gb|DR179438.1|DR179438 RTMNUT1_22_D07.b2_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_22_D07_A029 3', mRNA sequence
Length = 537
Score = 42.1 bits (21), Expect = 0.050
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 581 gatgtctacagttttggggtt 601
|||||||||||||||||||||
Sbjct: 260 gatgtctacagttttggggtt 240
>gb|DR691332.1|DR691332 EST1081419 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAD706 3' end, mRNA sequence
Length = 772
Score = 42.1 bits (21), Expect = 0.050
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggtt 601
|||||||||||||||||||||
Sbjct: 113 gatgtctacagttttggggtt 133
>gb|DT628418.1|DT628418 EST1157167 Subtracted pine embryo library, Lib_B Pinus taeda cDNA
clone PIMCX78 5' end, mRNA sequence
Length = 824
Score = 42.1 bits (21), Expect = 0.050
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggtt 601
|||||||||||||||||||||
Sbjct: 330 gatgtctacagttttggggtt 350
>gb|AW290318.1|AW290318 NXNV018F12F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV018F12 5', mRNA sequence
Length = 342
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 527 tttggttatcttgcgccagagtat 550
|||||||||||||| |||||||||
Sbjct: 28 tttggttatcttgcaccagagtat 51
>gb|BE582268.1|BE582268 NXCI_031_C02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_031_C02 5' similar to Arabidopsis
thaliana sequence At1g56720 protein kinase, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 538
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggt 600
||||||||||||||||||||
Sbjct: 315 gatgtctacagttttggggt 334
>gb|BG317789.1|BG317789 NXPV_005_G01_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_005_G01 5' similar to Arabidopsis
thaliana sequence At2g45590 putative protein kinase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 481
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 580 cgatgtctacagttttggggttct 603
|||||| |||||||||||||||||
Sbjct: 360 cgatgtttacagttttggggttct 383
>gb|BG318425.1|BG318425 NXPV_013_E05_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_013_E05 5' similar to Arabidopsis
thaliana sequence At1g10860 receptor-kinase isolog, 5'
partial see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 394
Score = 40.1 bits (20), Expect = 0.20
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggttctggtacttga 612
||||||||||||||||| || ||| |||||||
Sbjct: 80 gatgtctacagttttggagtactgttacttga 111
>gb|BG832875.1|BG832875 NXPV_081_G09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_081_G09 5' similar to Arabidopsis
thaliana sequence At1g10860 receptor-kinase isolog, 5'
partial see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 394
Score = 40.1 bits (20), Expect = 0.20
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggttctggtacttga 612
||||||||||||||||| || ||| |||||||
Sbjct: 80 gatgtctacagttttggagtactgttacttga 111
>gb|BI077164.1|BI077164 NXPV_089_F08_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_089_F08 5' similar to Arabidopsis
thaliana sequence At3g17840 receptor kinase, putative
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 303
Score = 40.1 bits (20), Expect = 0.20
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggttctggtacttga 612
||||||||||||||||| || ||| |||||||
Sbjct: 80 gatgtctacagttttggagtactgttacttga 111
>gb|BI643975.1|BI643975 NXPV_133_E01_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_133_E01 5' similar to Arabidopsis
thaliana sequence At3g17840 receptor kinase, putative
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 256
Score = 40.1 bits (20), Expect = 0.20
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggttctggtacttga 612
||||||||||||||||| || ||| |||||||
Sbjct: 80 gatgtctacagttttggagtactgttacttga 111
>gb|BQ696768.1|BQ696768 NXPV_045_A07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_045_A07 5' similar to Arabidopsis
thaliana sequence At1g10860 receptor-kinase isolog, 5'
partial see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 394
Score = 40.1 bits (20), Expect = 0.20
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggttctggtacttga 612
||||||||||||||||| || ||| |||||||
Sbjct: 80 gatgtctacagttttggagtactgttacttga 111
>gb|BQ696914.1|BQ696914 NXPV_046_G10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_046_G10 5' similar to Arabidopsis
thaliana sequence At3g17840 receptor kinase, putative
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 251
Score = 40.1 bits (20), Expect = 0.20
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggttctggtacttga 612
||||||||||||||||| || ||| |||||||
Sbjct: 80 gatgtctacagttttggagtactgttacttga 111
>gb|BQ700950.1|BQ700950 NXRV113_F02_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV113_F02 5' similar to Arabidopsis thaliana
sequence At1g56720 protein kinase, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 303
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggt 600
||||||||||||||||||||
Sbjct: 22 gatgtctacagttttggggt 41
>gb|CD025834.1|CD025834 NXSI_083_A03_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_083_A03 5' similar to Arabidopsis thaliana
sequence At1g31420 hypothetical protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 175
Score = 40.1 bits (20), Expect = 0.20
Identities = 71/89 (79%)
Strand = Plus / Plus
Query: 515 gttgcaggaacatttggttatcttgcgccagagtatatgcagtttggcagagccaccgag 574
||||| ||||||||||| ||||| || ||||| || ||||| ||||||||| || ||
Sbjct: 39 gttgctggaacatttggctatctggctccagaatacatgcacagtggcagagcaacagaa 98
Query: 575 aagaccgatgtctacagttttggggttct 603
||| ||||| || |||||||| |||||
Sbjct: 99 aagnnngatgtatatagttttggagttct 127
>gb|CD027008.1|CD027008 NXNV018F12 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV018F12 5' similar to Arabidopsis thaliana sequence
At3g05140 putative serine/threonine protein kinase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 342
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 527 tttggttatcttgcgccagagtat 550
|||||||||||||| |||||||||
Sbjct: 28 tttggttatcttgcaccagagtat 51
>gb|CF471819.1|CF471819 RTDS1_6_A09.g1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_6_A09_A015 5', mRNA sequence
Length = 732
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 458 tcagactttggacttgcaaa 477
||||||||||||||||||||
Sbjct: 370 tcagactttggacttgcaaa 389
>gb|CF477208.1|CF477208 RTWW3_6_G05.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_6_G05_A022 5', mRNA sequence
Length = 717
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 580 cgatgtctacagttttggggttct 603
|||||| |||||||||||||||||
Sbjct: 373 cgatgtttacagttttggggttct 396
>gb|CF664882.1|CF664882 RTCNT1_12_B09.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_12_B09_A029 5', mRNA sequence
Length = 734
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggt 600
||||||||||||||||||||
Sbjct: 20 gatgtctacagttttggggt 39
>gb|CF667809.1|CF667809 RTCNT1_32_D10.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_32_D10_A029 5', mRNA sequence
Length = 813
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 458 tcagactttggacttgcaaa 477
||||||||||||||||||||
Sbjct: 356 tcagactttggacttgcaaa 375
>gb|CF668841.1|CF668841 RTCNT1_39_B05.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_39_B05_A029 3', mRNA sequence
Length = 800
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 527 tttggttatcttgcgccagagtat 550
|||||||||||||| |||||||||
Sbjct: 586 tttggttatcttgcaccagagtat 563
>gb|BX682777.1|BX682777 BX682777 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 121E10, mRNA sequence
Length = 376
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggt 600
||||||||||||||||||||
Sbjct: 20 gatgtctacagttttggggt 39
>gb|DN445333.1|DN445333 EST941132 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PICUZ48 5' end, mRNA sequence
Length = 390
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 580 cgatgtctacagttttggggttct 603
|||||| |||||||||||||||||
Sbjct: 62 cgatgtttacagttttggggttct 85
>gb|DR161692.1|DR161692 RTFE1_13_G12.b1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_13_G12_A029 3', mRNA sequence
Length = 633
Score = 40.1 bits (20), Expect = 0.20
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 519 caggaacatttggttatcttgcgccaga 546
||||||||||||| |||||||| |||||
Sbjct: 432 caggaacatttgggtatcttgctccaga 405
>gb|DR178599.1|DR178599 RTMNUT1_12_F08.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_12_F08_A029 5', mRNA sequence
Length = 601
Score = 40.1 bits (20), Expect = 0.20
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 519 caggaacatttggttatcttgcgccaga 546
||||||||||||| |||||||| |||||
Sbjct: 476 caggaacatttgggtatcttgctccaga 503
>gb|DT626195.1|DT626195 EST1158119 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIMA815 5' end, mRNA sequence
Length = 1020
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 580 cgatgtctacagttttggggttct 603
|||||| |||||||||||||||||
Sbjct: 232 cgatgtttacagttttggggttct 255
>dbj|BD267259.1| Compositions isolated from plant cells and utilization of the same
in modifying plant cell signal transduction
Length = 539
Score = 40.1 bits (20), Expect = 0.20
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 580 cgatgtctacagttttggggttct 603
|||||| |||||||||||||||||
Sbjct: 343 cgatgtttacagttttggggttct 366
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 127,467
Number of Sequences: 355925
Number of extensions: 127467
Number of successful extensions: 33508
Number of sequences better than 0.5: 43
Number of HSP's better than 0.5 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33445
Number of HSP's gapped (non-prelim): 62
length of query: 1164
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1145
effective length of database: 210,514,662
effective search space: 241039287990
effective search space used: 241039287990
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)