BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2276425.2.1
(753 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF778026.1|BF778026 NXSI_081_A11_F NXSI (Nsf Xylem Side ... 52 3e-005
gb|BM133233.1|BM133233 NXLV_003_B06_F NXLV (Nsf Xylem Late ... 52 3e-005
gb|BM158356.1|BM158356 NXLV_033_B09_F NXLV (Nsf Xylem Late ... 52 3e-005
gb|CF388767.1|CF388767 RTDR2_15_E07.g1_A021 Loblolly pine r... 52 3e-005
gb|CF393340.1|CF393340 RTDR3_20_H04.g1_A022 Loblolly pine r... 52 3e-005
gb|CF395890.1|CF395890 RTDS2_19_B03.g1_A021 Drought-stresse... 52 3e-005
gb|CF472959.1|CF472959 RTDS1_12_B12.g1_A015 Drought-stresse... 52 3e-005
gb|CO172219.1|CO172219 NDL1_28_E08.b1_A029 Needles control ... 52 3e-005
gb|CO370336.1|CO370336 RTK1_67_E12.b1_A029 Roots minus pota... 52 3e-005
gb|DN461230.1|DN461230 EST957029 Sequencing ESTs from loblo... 52 3e-005
gb|DR054099.1|DR054099 RTCA1_15_F05.b1_A029 Roots minus cal... 52 3e-005
gb|DR054885.1|DR054885 RTCA1_20_D12.b1_A029 Roots minus cal... 52 3e-005
gb|DR095604.1|DR095604 STRR1_22_G11.b1_A033 Stem Response R... 52 3e-005
gb|DR095677.1|DR095677 STRR1_22_G11.g1_A033 Stem Response R... 52 3e-005
gb|DR688124.1|DR688124 EST1078208 Normalized pine embryo li... 52 3e-005
emb|AJ864706.1| Pinus taeda mRNA for alpha-1,6-xylosyltrans... 52 3e-005
gb|DR056665.1|DR056665 RTCA1_31_F06.g1_A029 Roots minus cal... 48 5e-004
gb|BF777799.1|BF777799 NXSI_075_G11_F NXSI (Nsf Xylem Side ... 44 0.008
>gb|BF778026.1|BF778026 NXSI_081_A11_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_081_A11 5' similar to Arabidopsis thaliana
sequence At4g02500 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 307
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 56 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 115
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 116 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 165
>gb|BM133233.1|BM133233 NXLV_003_B06_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_003_B06 5' similar to Arabidopsis thaliana
sequence At4g02500 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 278
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 68 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 127
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 128 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 177
>gb|BM158356.1|BM158356 NXLV_033_B09_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_033_B09 5' similar to Arabidopsis thaliana
sequence At4g02500 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 710
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 46 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 105
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 106 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 155
>gb|CF388767.1|CF388767 RTDR2_15_E07.g1_A021 Loblolly pine roots recovering from drought
DR2 Pinus taeda cDNA clone RTDR2_15_E07_A021 5', mRNA
sequence
Length = 716
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 297 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 356
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 357 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 406
>gb|CF393340.1|CF393340 RTDR3_20_H04.g1_A022 Loblolly pine roots recovering from drought
DR3 Pinus taeda cDNA clone RTDR3_20_H04_A022 5', mRNA
sequence
Length = 792
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 207 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 266
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 267 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 316
>gb|CF395890.1|CF395890 RTDS2_19_B03.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_19_B03_A021 5', mRNA sequence
Length = 537
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 326 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 385
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 386 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 435
>gb|CF472959.1|CF472959 RTDS1_12_B12.g1_A015 Drought-stressed loblolly pine roots DS1 Pinus
taeda cDNA clone RTDS1_12_B12_A015 5', mRNA sequence
Length = 793
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 121 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 180
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 181 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 230
>gb|CO172219.1|CO172219 NDL1_28_E08.b1_A029 Needles control Pinus taeda cDNA clone
NDL1_28_E08_A029 3', mRNA sequence
Length = 687
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 123 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgctggccgctggtc 182
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 183 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 232
>gb|CO370336.1|CO370336 RTK1_67_E12.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_67_E12_A029 3', mRNA sequence
Length = 778
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 169 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 228
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 229 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 278
>gb|DN461230.1|DN461230 EST957029 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPII789 5' end, mRNA sequence
Length = 917
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 282 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 341
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 342 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 391
>gb|DR054099.1|DR054099 RTCA1_15_F05.b1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_15_F05_A029 3', mRNA sequence
Length = 539
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Minus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 382 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgctggccgctggtc 323
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 322 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 273
>gb|DR054885.1|DR054885 RTCA1_20_D12.b1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_20_D12_A029 3', mRNA sequence
Length = 755
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 121 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 180
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 181 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 230
>gb|DR095604.1|DR095604 STRR1_22_G11.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_22_G11_A033 3', mRNA sequence
Length = 815
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Minus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 672 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 613
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 612 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 563
>gb|DR095677.1|DR095677 STRR1_22_G11.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_22_G11_A033 5', mRNA sequence
Length = 737
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Minus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 688 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 629
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 628 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 579
>gb|DR688124.1|DR688124 EST1078208 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAC107 3' end, mRNA sequence
Length = 790
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 506 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 565
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 566 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 615
>emb|AJ864706.1| Pinus taeda mRNA for alpha-1,6-xylosyltransferase (x34.1 gene)
Length = 1473
Score = 52.0 bits (26), Expect = 3e-005
Identities = 89/110 (80%)
Strand = Plus / Plus
Query: 101 tacgaggagatgcttgagaattacaagccagggctcggcgatcaccggtggccactcgtc 160
|||||||||||| | ||||| || | || ||||| || |||||||| ||||| || |||
Sbjct: 1054 tacgaggagatgatggagaagcaccacccggggcttggggatcaccgttggccgctggtc 1113
Query: 161 acacactttgtcgggtgcaagccgtgtggcaaatttggagactaccctgt 210
|| ||||||||||| ||||| || || || ||| |||| || ||||||||
Sbjct: 1114 actcactttgtcggctgcaaaccctgcggtaaagttggggattaccctgt 1163
>gb|DR056665.1|DR056665 RTCA1_31_F06.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_31_F06_A029 5', mRNA sequence
Length = 597
Score = 48.1 bits (24), Expect = 5e-004
Identities = 66/80 (82%)
Strand = Plus / Minus
Query: 131 gggctcggcgatcaccggtggccactcgtcacacactttgtcgggtgcaagccgtgtggc 190
||||| || |||||||| ||||| || ||||| ||||||||||| ||||| || || ||
Sbjct: 578 gggcttggggatcaccgttggccgctggtcactcactttgtcggctgcaaaccctgcggt 519
Query: 191 aaatttggagactaccctgt 210
||| |||| || ||||||||
Sbjct: 518 aaagttggggattaccctgt 499
>gb|BF777799.1|BF777799 NXSI_075_G11_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_075_G11 5' similar to Arabidopsis thaliana
sequence At4g02500 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 443
Score = 44.1 bits (22), Expect = 0.008
Identities = 58/70 (82%)
Strand = Plus / Plus
Query: 141 atcaccggtggccactcgtcacacactttgtcgggtgcaagccgtgtggcaaatttggag 200
||||||| ||||| || ||||| ||||||||||| ||||| || || || ||| |||| |
Sbjct: 1 atcaccgttggccgctggtcactcactttgtcggctgcaaaccctgcggtaaagttgggg 60
Query: 201 actaccctgt 210
| ||||||||
Sbjct: 61 attaccctgt 70
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 89,555
Number of Sequences: 355925
Number of extensions: 89555
Number of successful extensions: 23908
Number of sequences better than 0.5: 18
Number of HSP's better than 0.5 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 23889
Number of HSP's gapped (non-prelim): 19
length of query: 753
length of database: 217,277,237
effective HSP length: 19
effective length of query: 734
effective length of database: 210,514,662
effective search space: 154517761908
effective search space used: 154517761908
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)