BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2192958.2.1
(1629 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DR117184.1|DR117184 RTMG1_5_G03.b1_A029 Roots minus magn... 105 6e-021
gb|CF389500.1|CF389500 RTDR2_7_F04.g1_A021 Loblolly pine ro... 100 3e-019
gb|CF395787.1|CF395787 RTDS2_17_A05.g1_A021 Drought-stresse... 100 3e-019
gb|CF473569.1|CF473569 RTWW2_3_F06.g1_A021 Well-watered lob... 100 3e-019
gb|CF475049.1|CF475049 RTWW2_5_F07.g1_A021 Well-watered lob... 100 3e-019
gb|CF667373.1|CF667373 RTCNT1_29_G06.g1_A029 Root control P... 100 3e-019
gb|CO200960.1|CO200960 RTCNT2_2_E08.g1_A029 Root control 2 ... 100 3e-019
gb|CO364302.1|CO364302 RTK1_14_H10.g1_A029 Roots minus pota... 100 3e-019
gb|CO364533.1|CO364533 RTK1_16_F09.b1_A029 Roots minus pota... 100 3e-019
gb|CO365638.1|CO365638 RTK1_18_G01.b1_A029 Roots minus pota... 100 3e-019
gb|CO366611.1|CO366611 RTK1_28_H11.g1_A029 Roots minus pota... 100 3e-019
gb|CO366806.1|CO366806 RTK1_30_F01.b1_A029 Roots minus pota... 100 3e-019
gb|CV032615.1|CV032615 RTNACL1_17_G06.b1_A029 Roots plus ad... 100 3e-019
gb|CX713080.1|CX713080 RTPQ1_6_H02.g1_A032 Roots treated wi... 100 3e-019
gb|CX715248.1|CX715248 RTPQ1_32_H07.g1_A032 Roots treated w... 100 3e-019
gb|DR048975.1|DR048975 RTBOR1_12_A06.g1_A029 Roots plus add... 100 3e-019
gb|DR060019.1|DR060019 RTNIT1_25_E05.b1_A029 Roots minus ni... 100 3e-019
gb|DR079275.1|DR079275 RTFEPL1_10_F02.b1_A029 Roots plus ad... 100 3e-019
gb|DR168806.1|DR168806 RTPHOS1_28_A08.b1_A029 Roots minus p... 100 3e-019
gb|DR388710.1|DR388710 RTHG1_30_B09.b1_A029 Roots plus adde... 100 3e-019
gb|DR688764.1|DR688764 EST1078849 Normalized pine embryo li... 100 3e-019
gb|DR695054.1|DR695054 EST1085147 Normalized pine embryo li... 100 3e-019
gb|DR161623.1|DR161623 RTFE1_12_H10.g1_A029 Roots minus iro... 96 5e-018
gb|BX249446.1|BX249446 BX249446 Pinus pinaster differenciat... 92 9e-017
gb|CO165319.1|CO165319 FLD1_53_F10.g1_A029 Root flooded Pin... 92 9e-017
gb|DR682449.1|DR682449 EST1072524 Normalized pine embryo li... 92 9e-017
gb|AA556894.1|AA556894 736 Loblolly pine C Pinus taeda cDNA... 90 3e-016
gb|BI397729.1|BI397729 NXPV_104_F04_F NXPV (Nsf Xylem Plani... 84 2e-014
gb|BX252596.1|BX252596 BX252596 Pinus pinaster differenciat... 82 8e-014
gb|BX252900.1|BX252900 BX252900 Pinus pinaster differenciat... 82 8e-014
gb|BE123609.1|BE123609 NXNV_146_C11_F Nsf Xylem Normal wood... 82 8e-014
gb|CF390139.1|CF390139 RTDR2_12_E04.g1_A021 Loblolly pine r... 82 8e-014
gb|CF473550.1|CF473550 RTWW2_3_H01.g1_A021 Well-watered lob... 82 8e-014
gb|CF669350.1|CF669350 RTCNT1_42_F05.g1_A029 Root control P... 82 8e-014
gb|CO368425.1|CO368425 RTK1_40_C07.g1_A029 Roots minus pota... 82 8e-014
gb|CV033295.1|CV033295 RTNACL1_33_D06.g1_A029 Roots plus ad... 82 8e-014
gb|CX651299.1|CX651299 COLD1_51_A08.g1_A029 Root cold Pinus... 82 8e-014
gb|DR060009.1|DR060009 RTNIT1_25_D07.b1_A029 Roots minus ni... 82 8e-014
gb|DR089543.1|DR089543 RTAL1_9_H03.b1_A029 Roots plus added... 82 8e-014
gb|DR163547.1|DR163547 RTFE1_43_C01.g1_A029 Roots minus iro... 82 8e-014
gb|DR182342.1|DR182342 RTMNUT1_44_A01.g1_A029 Roots minus m... 82 8e-014
gb|DR177127.1|DR177127 RTMNUT1_3_G04.b1_A029 Roots minus mi... 80 3e-013
gb|BM427813.1|BM427813 NXRV_003_F06_F NXRV (Nsf Xylem Root ... 78 1e-012
gb|AW064596.1|AW064596 ST33D09 Pine TriplEx shoot tip libra... 76 5e-012
gb|BX681362.1|BX681362 BX681362 RS Pinus pinaster cDNA clon... 70 3e-010
gb|CO364076.1|CO364076 RTK1_13_C01.g1_A029 Roots minus pota... 70 3e-010
gb|CF393694.1|CF393694 RTDR3_15_G07.g1_A022 Loblolly pine r... 66 5e-009
gb|DR050649.1|DR050649 RTBOR1_24_G09.g1_A029 Roots plus add... 66 5e-009
gb|DR117717.1|DR117717 RTMG1_8_E10.g1_A029 Roots minus magn... 66 5e-009
gb|DR682369.1|DR682369 EST1072444 Normalized pine embryo li... 66 5e-009
gb|DR688945.1|DR688945 EST1079031 Normalized pine embryo li... 66 5e-009
gb|DR694055.1|DR694055 EST1084145 Normalized pine embryo li... 66 5e-009
gb|DT630953.1|DT630953 EST1145884 Normalized pine embryo li... 66 5e-009
gb|DT635170.1|DT635170 EST1150101 Normalized pine embryo li... 66 5e-009
gb|DT638503.1|DT638503 EST1153434 Normalized pine embryo li... 66 5e-009
gb|DR109755.1|DR109755 RTS1_4_B05.g1_A029 Roots minus sulfu... 64 2e-008
gb|CD016396.1|CD016396 NXCI_043_A05_F NXCI (Nsf Xylem Compr... 60 3e-007
gb|DR387999.1|DR387999 RTHG1_25_C04.g1_A029 Roots plus adde... 60 3e-007
gb|CF479400.1|CF479400 RTWW3_23_B10.g1_A022 Well-watered lo... 58 1e-006
gb|CO176666.1|CO176666 NDL1_63_A09.g1_A029 Needles control ... 58 1e-006
gb|CV033965.1|CV033965 RTNACL1_37_E07.g1_A029 Roots plus ad... 58 1e-006
gb|CV034654.1|CV034654 RTNACL1_10_E02.g1_A029 Roots plus ad... 58 1e-006
gb|CX646771.1|CX646771 COLD1_11_A08.g1_A029 Root cold Pinus... 58 1e-006
gb|CX713959.1|CX713959 RTPQ1_15_C12.g1_A032 Roots treated w... 58 1e-006
gb|DR047440.1|DR047440 RTBOR1_1_C05.b1_A029 Roots plus adde... 58 1e-006
gb|DR117389.1|DR117389 RTMG1_6_E04.g1_A029 Roots minus magn... 58 1e-006
gb|BG275137.1|BG275137 NXSI_140_C06_F NXSI (Nsf Xylem Side ... 54 2e-005
gb|CO172429.1|CO172429 NDL1_29_E03.g1_A029 Needles control ... 54 2e-005
gb|CO174583.1|CO174583 NDL1_44_H05.g1_A029 Needles control ... 54 2e-005
gb|CO362352.1|CO362352 RTK1_3_B12.b1_A029 Roots minus potas... 54 2e-005
gb|DN626434.1|DN626434 EST977250 Subtracted pine embryo lib... 54 2e-005
gb|DN627235.1|DN627235 EST978051 Subtracted pine embryo lib... 54 2e-005
gb|DN629909.1|DN629909 EST980725 Subtracted pine embryo lib... 54 2e-005
gb|DN630200.1|DN630200 EST981016 Subtracted pine embryo lib... 54 2e-005
gb|DN631439.1|DN631439 EST982255 Subtracted pine embryo lib... 54 2e-005
gb|DN631879.1|DN631879 EST982695 Subtracted pine embryo lib... 54 2e-005
gb|DN632035.1|DN632035 EST982851 Subtracted pine embryo lib... 54 2e-005
gb|DN632290.1|DN632290 EST983106 Subtracted pine embryo lib... 54 2e-005
gb|DN632324.1|DN632324 EST983140 Subtracted pine embryo lib... 54 2e-005
gb|DN633318.1|DN633318 EST984134 Subtracted pine embryo lib... 54 2e-005
gb|DN633740.1|DN633740 EST984556 Subtracted pine embryo lib... 54 2e-005
gb|DN633945.1|DN633945 EST984761 Subtracted pine embryo lib... 54 2e-005
gb|DN634184.1|DN634184 EST985000 Subtracted pine embryo lib... 54 2e-005
gb|DT630232.1|DT630232 EST1154644 Subtracted pine embryo li... 54 2e-005
gb|DT630485.1|DT630485 EST1154897 Subtracted pine embryo li... 54 2e-005
gb|BQ702053.1|BQ702053 NXSI_123_G11_F NXSI (Nsf Xylem Side ... 52 7e-005
gb|AW754622.1|AW754622 PC04D07 Pine TriplEx pollen cone lib... 50 3e-004
gb|AW984855.1|AW984855 NXNV_119_D12_F Nsf Xylem Normal wood... 50 3e-004
gb|BF517796.1|BF517796 NXSI_031_C12_F NXSI (Nsf Xylem Side ... 50 3e-004
gb|BG318920.1|BG318920 NXPV_021_E01_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BG318962.1|BG318962 NXPV_021_H11_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BG833034.1|BG833034 NXPV_088_C02_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BI643932.1|BI643932 NXPV_129_E11_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BM157616.1|BM157616 NXLV_023_C12_F NXLV (Nsf Xylem Late ... 50 3e-004
gb|BQ696007.1|BQ696007 NXPV_035_D01_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BQ696482.1|BQ696482 NXPV_041_G09_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BQ696579.1|BQ696579 NXPV_042_H06_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BQ696893.1|BQ696893 NXPV_046_F01_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BQ697630.1|BQ697630 NXPV_059_A01_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BQ697854.1|BQ697854 NXPV_061_F10_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|BQ698557.1|BQ698557 NXPV_071_D05_F NXPV (Nsf Xylem Plani... 50 3e-004
gb|CF389385.1|CF389385 RTDR2_7_F04.b1_A021 Loblolly pine ro... 50 3e-004
gb|CF391391.1|CF391391 RTDR3_1_C05.g1_A022 Loblolly pine ro... 50 3e-004
gb|CF473526.1|CF473526 RTWW2_3_F06.b2_A021 Well-watered lob... 50 3e-004
gb|CF475025.1|CF475025 RTWW2_5_F07.b1_A021 Well-watered lob... 50 3e-004
gb|CF667296.1|CF667296 RTCNT1_29_G06.b1_A029 Root control P... 50 3e-004
gb|BX678604.1|BX678604 BX678604 RS Pinus pinaster cDNA clon... 50 3e-004
gb|CO165239.1|CO165239 FLD1_53_F10.b1_A029 Root flooded Pin... 50 3e-004
gb|CO165967.1|CO165967 FLD1_58_H07.b1_A029 Root flooded Pin... 50 3e-004
gb|CO172351.1|CO172351 NDL1_29_E03.b1_A029 Needles control ... 50 3e-004
gb|CO174494.1|CO174494 NDL1_44_H05.b1_A029 Needles control ... 50 3e-004
gb|CO364214.1|CO364214 RTK1_14_H10.b1_A029 Roots minus pota... 50 3e-004
gb|CO364617.1|CO364617 RTK1_16_F09.g1_A029 Roots minus pota... 50 3e-004
gb|CO365720.1|CO365720 RTK1_18_G01.g1_A029 Roots minus pota... 50 3e-004
gb|CO366239.1|CO366239 RTK1_26_E05.g1_A029 Roots minus pota... 50 3e-004
gb|CO366526.1|CO366526 RTK1_28_H11.b1_A029 Roots minus pota... 50 3e-004
gb|CO366880.1|CO366880 RTK1_30_F01.g1_A029 Roots minus pota... 50 3e-004
gb|CO366945.1|CO366945 RTK1_31_E03.b1_A029 Roots minus pota... 50 3e-004
gb|CV032418.1|CV032418 RTNACL1_8_B01.b1_A029 Roots plus add... 50 3e-004
gb|CV032482.1|CV032482 RTNACL1_8_B01.g1_A029 Roots plus add... 50 3e-004
gb|CV034642.1|CV034642 RTNACL1_10_C11.g1_A029 Roots plus ad... 50 3e-004
gb|CV035015.1|CV035015 RTNACL1_13_C12.b1_A029 Roots plus ad... 50 3e-004
gb|CV036284.1|CV036284 RTNACL1_58_C04.b1_A029 Roots plus ad... 50 3e-004
gb|CV036339.1|CV036339 RTNACL1_58_C04.g1_A029 Roots plus ad... 50 3e-004
gb|CX713004.1|CX713004 RTPQ1_6_H02.b1_A032 Roots treated wi... 50 3e-004
gb|CX714743.1|CX714743 RTPQ1_26_F01.b1_A032 Roots treated w... 50 3e-004
gb|CX715196.1|CX715196 RTPQ1_32_H07.b1_A032 Roots treated w... 50 3e-004
gb|DN627012.1|DN627012 EST977828 Subtracted pine embryo lib... 50 3e-004
gb|DN627586.1|DN627586 EST978402 Subtracted pine embryo lib... 50 3e-004
gb|DN629335.1|DN629335 EST980151 Subtracted pine embryo lib... 50 3e-004
gb|DN629372.1|DN629372 EST980188 Subtracted pine embryo lib... 50 3e-004
gb|DN629853.1|DN629853 EST980669 Subtracted pine embryo lib... 50 3e-004
gb|DN632951.1|DN632951 EST983767 Subtracted pine embryo lib... 50 3e-004
gb|DN633510.1|DN633510 EST984326 Subtracted pine embryo lib... 50 3e-004
gb|DR014382.1|DR014382 HEAT1_49_D08.b1_A029 Root at 37 C fo... 50 3e-004
gb|DR014461.1|DR014461 HEAT1_49_D08.g1_A029 Root at 37 C fo... 50 3e-004
gb|DR014726.1|DR014726 HEAT1_51_F07.b1_A029 Root at 37 C fo... 50 3e-004
gb|DR014810.1|DR014810 HEAT1_51_F07.g1_A029 Root at 37 C fo... 50 3e-004
gb|DR048804.1|DR048804 RTBOR1_11_H04.b1_A029 Roots plus add... 50 3e-004
gb|DR048894.1|DR048894 RTBOR1_12_A06.b1_A029 Roots plus add... 50 3e-004
gb|DR049935.1|DR049935 RTBOR1_20_C11.b1_A029 Roots plus add... 50 3e-004
gb|DR060098.1|DR060098 RTNIT1_25_E05.g1_A029 Roots minus ni... 50 3e-004
gb|DR089187.1|DR089187 RTAL1_7_C08.b1_A029 Roots plus added... 50 3e-004
gb|DR089261.1|DR089261 RTAL1_7_C08.g1_A029 Roots plus added... 50 3e-004
gb|DR116528.1|DR116528 RTMG1_1_C01.b1_A029 Roots minus magn... 50 3e-004
gb|DR116882.1|DR116882 RTMG1_3_H01.b1_A029 Roots minus magn... 50 3e-004
gb|DR116965.1|DR116965 RTMG1_3_H01.g1_A029 Roots minus magn... 50 3e-004
gb|DR117253.1|DR117253 RTMG1_5_G03.g1_A029 Roots minus magn... 50 3e-004
gb|DR118098.1|DR118098 RTMG1_11_D01.b1_A029 Roots minus mag... 50 3e-004
gb|DR119412.1|DR119412 RTMG1_23_C12.b1_A029 Roots minus mag... 50 3e-004
gb|DR119493.1|DR119493 RTMG1_23_C12.g1_A029 Roots minus mag... 50 3e-004
gb|DR119658.1|DR119658 RTMG1_24_D08.g1_A029 Roots minus mag... 50 3e-004
gb|DR120523.1|DR120523 RTMG1_30_F12.b1_A029 Roots minus mag... 50 3e-004
gb|DR120647.1|DR120647 RTMG1_31_C05.b1_A029 Roots minus mag... 50 3e-004
gb|DR120732.1|DR120732 RTMG1_31_C05.g1_A029 Roots minus mag... 50 3e-004
gb|DR160254.1|DR160254 RTFE1_5_A04.b1_A029 Roots minus iron... 50 3e-004
gb|DR160339.1|DR160339 RTFE1_5_A04.g1_A029 Roots minus iron... 50 3e-004
gb|DR161713.1|DR161713 RTFE1_13_B03.g1_A029 Roots minus iro... 50 3e-004
gb|DR161884.1|DR161884 RTFE1_14_B03.g1_A029 Roots minus iro... 50 3e-004
gb|DR164012.1|DR164012 RTFE1_46_G06.b1_A029 Roots minus iro... 50 3e-004
gb|DR164102.1|DR164102 RTFE1_46_G06.g1_A029 Roots minus iro... 50 3e-004
gb|DR167506.1|DR167506 RTPHOS1_19_F09.b1_A029 Roots minus p... 50 3e-004
gb|DR167936.1|DR167936 RTPHOS1_22_C09.b1_A029 Roots minus p... 50 3e-004
gb|DR168006.1|DR168006 RTPHOS1_22_C09.g1_A029 Roots minus p... 50 3e-004
gb|DR168878.1|DR168878 RTPHOS1_28_A08.g1_A029 Roots minus p... 50 3e-004
gb|DR177087.1|DR177087 RTMNUT1_3_B06.b1_A029 Roots minus mi... 50 3e-004
gb|DR177160.1|DR177160 RTMNUT1_3_B06.g1_A029 Roots minus mi... 50 3e-004
gb|DR177206.1|DR177206 RTMNUT1_3_G04.g1_A029 Roots minus mi... 50 3e-004
gb|DR179639.1|DR179639 RTMNUT1_23_H08.b2_A029 Roots minus m... 50 3e-004
gb|DR181777.1|DR181777 RTMNUT1_41_A08.b1_A029 Roots minus m... 50 3e-004
gb|DR181859.1|DR181859 RTMNUT1_41_A08.g1_A029 Roots minus m... 50 3e-004
gb|DR386746.1|DR386746 RTHG1_17_E09.b1_A029 Roots plus adde... 50 3e-004
gb|DR388505.1|DR388505 RTHG1_28_E04.g1_A029 Roots plus adde... 50 3e-004
gb|DR742143.1|DR742143 RTCU1_2_B07.b1_A029 Roots plus added... 50 3e-004
gb|DR742208.1|DR742208 RTCU1_2_B07.g1_A029 Roots plus added... 50 3e-004
gb|AW290737.1|AW290737 NXNV046D06F Nsf Xylem Normal wood Ve... 46 0.005
gb|BF186264.1|BF186264 NXCI_135_C06_F NXCI (Nsf Xylem Compr... 46 0.005
gb|BM367324.1|BM367324 NXLV_047_G03_F NXLV (Nsf Xylem Late ... 46 0.005
gb|BQ290662.1|BQ290662 NXRV048_A07_F NXRV (Nsf Xylem Root w... 46 0.005
gb|BQ290752.1|BQ290752 NXRV049_C01_F NXRV (Nsf Xylem Root w... 46 0.005
gb|BQ702261.1|BQ702261 NXSI_126_E12_F NXSI (Nsf Xylem Side ... 46 0.005
gb|BQ702345.1|BQ702345 NXSI_127_F04_F NXSI (Nsf Xylem Side ... 46 0.005
gb|CD027403.1|CD027403 NXNV046D06 Nsf Xylem Normal wood Ver... 46 0.005
gb|DR161800.1|DR161800 RTFE1_14_B03.b1_A029 Roots minus iro... 46 0.005
gb|DR386756.1|DR386756 RTHG1_17_F07.b1_A029 Roots plus adde... 44 0.018
gb|AW981550.1|AW981550 PC13H10 Pine TriplEx pollen cone lib... 42 0.071
gb|DR049412.1|DR049412 RTBOR1_16_G03.b1_A029 Roots plus add... 42 0.071
gb|DR161633.1|DR161633 RTFE1_13_B03.b1_A029 Roots minus iro... 42 0.071
gb|DR388422.1|DR388422 RTHG1_28_E04.b1_A029 Roots plus adde... 42 0.071
gb|DR050412.1|DR050412 RTBOR1_23_G10.b1_A029 Roots plus add... 40 0.28
gb|DR050486.1|DR050486 RTBOR1_23_G10.g1_A029 Roots plus add... 40 0.28
>gb|DR117184.1|DR117184 RTMG1_5_G03.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_5_G03_A029 3', mRNA sequence
Length = 896
Score = 105 bits (53), Expect = 6e-021
Identities = 188/230 (81%), Gaps = 6/230 (2%)
Strand = Plus / Plus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||| |||||||||| ||||||||||| |||||
Sbjct: 468 ctgctgctaccacctccaaaagga-ttcc--caccaaagaacgactggaatatatcaaat 524
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
|||||||| || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 525 ggatcgtga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 581
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 582 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 641
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 642 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 691
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 314 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 373
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 374 tgacaacttctttgatgttccattgta 400
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 153 actttttcacccttgcattgtgggcatct 181
>gb|CF389500.1|CF389500 RTDR2_7_F04.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_7_F04_A021 5', mRNA sequence
Length = 756
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 493 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 437
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 436 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 380
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 379 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 320
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 319 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 270
>gb|CF395787.1|CF395787 RTDS2_17_A05.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_17_A05_A021 5', mRNA sequence
Length = 708
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 357 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 301
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 300 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 244
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 243 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 184
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 183 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 134
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 511 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 452
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 451 tgacaacttctttgatgttccattgta 425
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 672 actttttcacccttgcattgtgggcatct 644
>gb|CF473569.1|CF473569 RTWW2_3_F06.g1_A021 Well-watered loblolly pine roots WW2 Pinus taeda
cDNA clone RTWW2_3_F06_A021 5', mRNA sequence
Length = 683
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 299 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 243
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 242 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 186
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 185 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 126
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 125 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 76
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 453 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 394
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 393 tgacaacttctttgatgttccattgta 367
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 614 actttttcacccttgcattgtgggcatct 586
>gb|CF475049.1|CF475049 RTWW2_5_F07.g1_A021 Well-watered loblolly pine roots WW2 Pinus taeda
cDNA clone RTWW2_5_F07_A021 5', mRNA sequence
Length = 724
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 452 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 396
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 395 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 339
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 338 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 279
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 278 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 229
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 606 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 547
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 546 tgacaacttctttgatgttccattgta 520
>gb|CF667373.1|CF667373 RTCNT1_29_G06.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_29_G06_A029 5', mRNA sequence
Length = 649
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 299 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 243
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 242 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 186
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 185 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 126
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 125 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 76
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 453 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 394
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 393 tgacaacttctttgatgttccattgta 367
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 614 actttttcacccttgcattgtgggcatct 586
>gb|CO200960.1|CO200960 RTCNT2_2_E08.g1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_2_E08_A029 5', mRNA sequence
Length = 713
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 597 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 541
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 540 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 484
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 483 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 424
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 423 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 374
>gb|CO364302.1|CO364302 RTK1_14_H10.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_14_H10_A029 5', mRNA sequence
Length = 865
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 333 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 277
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 276 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 220
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 219 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 160
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 159 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 110
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 785 ccctttctcttgaacttgggatgctcctt 813
|||||||||||||| ||||||||||||||
Sbjct: 810 ccctttctcttgaatttgggatgctcctt 782
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 487 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 428
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 427 tgacaacttctttgatgttccattgta 401
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 648 actttttcacccttgcattgtgggcatct 620
>gb|CO364533.1|CO364533 RTK1_16_F09.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_16_F09_A029 3', mRNA sequence
Length = 833
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Plus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 444 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 500
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 501 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 557
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 558 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 617
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 618 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 667
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 290 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 349
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 350 tgacaacttctttgatgttccattgta 376
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 129 actttttcacccttgcattgtgggcatct 157
>gb|CO365638.1|CO365638 RTK1_18_G01.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_18_G01_A029 3', mRNA sequence
Length = 806
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Plus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 214 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 270
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 271 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 327
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 328 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 387
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 388 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 437
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 60 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 119
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 120 tgacaacttctttgatgttccattgta 146
>gb|CO366611.1|CO366611 RTK1_28_H11.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_28_H11_A029 5', mRNA sequence
Length = 782
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 596 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 540
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 539 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 483
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 482 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 423
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 422 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 373
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 750 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 691
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 690 tgacaacttctttgatgttccattgta 664
>gb|CO366806.1|CO366806 RTK1_30_F01.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_30_F01_A029 3', mRNA sequence
Length = 794
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Plus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 188 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 244
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 245 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 301
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 302 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 361
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 362 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 411
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 34 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 93
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 94 tgacaacttctttgatgttccattgta 120
>gb|CV032615.1|CV032615 RTNACL1_17_G06.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_17_G06_A029 3', mRNA sequence
Length = 753
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Plus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 244 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 300
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 301 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 357
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 358 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 417
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 418 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 467
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 90 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 149
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 150 tgacaacttctttgatgttccattgta 176
>gb|CX713080.1|CX713080 RTPQ1_6_H02.g1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_6_H02_A032 5', mRNA sequence
Length = 653
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 472 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 416
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 415 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 359
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 358 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 299
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 298 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 249
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 626 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 567
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 566 tgacaacttctttgatgttccattgta 540
>gb|CX715248.1|CX715248 RTPQ1_32_H07.g1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_32_H07_A032 5', mRNA sequence
Length = 708
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 472 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 416
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 415 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 359
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 358 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 299
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 298 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 249
>gb|DR048975.1|DR048975 RTBOR1_12_A06.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_12_A06_A029 5', mRNA sequence
Length = 806
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 547 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 491
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 490 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 434
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 433 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 374
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 373 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 324
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 701 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 642
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 641 tgacaacttctttgatgttccattgta 615
>gb|DR060019.1|DR060019 RTNIT1_25_E05.b1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_25_E05_A029 3', mRNA sequence
Length = 754
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Plus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 252 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 308
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 309 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 365
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 366 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 425
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 426 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 475
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 98 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 157
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 158 tgacaacttctttgatgttccattgta 184
>gb|DR079275.1|DR079275 RTFEPL1_10_F02.b1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_10_F02_A029 3', mRNA sequence
Length = 847
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 503 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 447
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 446 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 390
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 389 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 330
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 329 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 280
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 657 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 598
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 597 tgacaacttctttgatgttccattgta 571
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 818 actttttcacccttgcattgtgggcatct 790
>gb|DR168806.1|DR168806 RTPHOS1_28_A08.b1_A029 Roots minus phosphorous Pinus taeda cDNA clone
RTPHOS1_28_A08_A029 3', mRNA sequence
Length = 784
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Plus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 189 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 245
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 246 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 302
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 303 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 362
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 363 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 412
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 35 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 94
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 95 tgacaacttctttgatgttccattgta 121
>gb|DR388710.1|DR388710 RTHG1_30_B09.b1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_30_B09_A029 3', mRNA sequence
Length = 799
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Plus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 464 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 520
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 521 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 577
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 578 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 637
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 638 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 687
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Plus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 310 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 369
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 370 tgacaacttctttgatgttccattgta 396
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 149 actttttcacccttgcattgtgggcatct 177
>gb|DR688764.1|DR688764 EST1078849 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWACA31 3' end, mRNA sequence
Length = 662
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 411 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 355
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 354 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 298
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 297 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 238
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 237 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 188
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 565 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 506
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 505 tgacaacttctttgatgttccattgta 479
>gb|DR695054.1|DR695054 EST1085147 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAEJ90 3' end, mRNA sequence
Length = 814
Score = 99.6 bits (50), Expect = 3e-019
Identities = 186/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 520 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 464
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 463 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 407
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 406 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 347
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 346 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 297
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 674 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 615
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 614 tgacaacttctttgatgttccattgta 588
>gb|DR161623.1|DR161623 RTFE1_12_H10.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_12_H10_A029 5', mRNA sequence
Length = 570
Score = 95.6 bits (48), Expect = 5e-018
Identities = 184/228 (80%), Gaps = 6/228 (2%)
Strand = Plus / Minus
Query: 1297 gctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaaggg 1356
||||| ||||||||||||||| |||||||| ||||| ||||||||||| ||||| ||
Sbjct: 570 gctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaatgg 514
Query: 1357 atcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattgatc 1416
||| || || || || || |||||||| || ||||| |||||||| || || |||||
Sbjct: 513 atcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactgatc 457
Query: 1417 ataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttgaa 1476
|||||| |||| || ||||||||||| || ||||| || |||||||| || ||||| ||
Sbjct: 456 ataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttccttaaa 397
Query: 1477 cttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 396 cttttctggatctccacccttgtccggatggtttttgatagcagcctt 349
>gb|BX249446.1|BX249446 BX249446 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP024B04, mRNA sequence
Length = 669
Score = 91.7 bits (46), Expect = 9e-017
Identities = 185/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| ||||||| ||||| ||||||||||| |||||
Sbjct: 411 ctgctgctaccacctccaaaaggatttccaccg---aagaacgactggaatatatcaaat 355
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 354 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 298
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || |||||||| |||||||| || |||||
Sbjct: 297 tcataaatgtctcttttctcaggatcactaagtacctcataggcctgagcaagttcctta 238
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || ||||| || || ||||| ||||| || |||||
Sbjct: 237 aacttttctggatctccacccttatccggatggtttttgatagcagcctt 188
>gb|CO165319.1|CO165319 FLD1_53_F10.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_53_F10_A029 5', mRNA sequence
Length = 836
Score = 91.7 bits (46), Expect = 9e-017
Identities = 185/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 493 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 437
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || | |
Sbjct: 436 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactca 380
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || |||||
Sbjct: 379 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctta 320
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 319 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 270
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 647 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 588
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 587 tgacaacttctttgatgttccattgta 561
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 808 actttttcacccttgcattgtgggcatct 780
>gb|DR682449.1|DR682449 EST1072524 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAA990 3' end, mRNA sequence
Length = 791
Score = 91.7 bits (46), Expect = 9e-017
Identities = 185/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 302 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 246
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 245 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 189
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || ||||| || |||||||| || ||||
Sbjct: 188 tcataaatgtctcttttctcaggatcactaagtacctcgtaggcctgagcaagttcctca 129
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 128 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 79
Score = 46.1 bits (23), Expect = 0.005
Identities = 71/87 (81%)
Strand = Plus / Minus
Query: 1141 tgaagctccagactttgaacccttaccattgcacttggagcagagaacactgcgggacag 1200
|||||| ||||||||||| || || || ||||| || ||||| |||||| | || || ||
Sbjct: 456 tgaagcgccagactttgaccctttccccttgcatttagagcacagaacatttcgagatag 397
Query: 1201 agagagcttctttgatgtgccattgta 1227
|| | |||||||||||| ||||||||
Sbjct: 396 tgacaacttctttgatgttccattgta 370
Score = 44.1 bits (22), Expect = 0.018
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 785 ccctttctcttgaacttgggatgctc 810
|||||||||||||| |||||||||||
Sbjct: 778 ccctttctcttgaatttgggatgctc 753
Score = 42.1 bits (21), Expect = 0.071
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 980 actttatcacctttgcattgtgggcatct 1008
||||| ||||| |||||||||||||||||
Sbjct: 617 actttttcacccttgcattgtgggcatct 589
>gb|AA556894.1|AA556894 736 Loblolly pine C Pinus taeda cDNA clone 7C12B, mRNA sequence
Length = 605
Score = 89.7 bits (45), Expect = 3e-016
Identities = 184/230 (80%), Gaps = 6/230 (2%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 431 ctgctgctaccacctccaaaaggatttccacca---aagaacgactggaatatatcaaat 375
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || ||||||| || ||||| |||||||| || || |||
Sbjct: 374 ggatcatga---ccgccgccgccacccattcnttctttgagtgcatcctccccgtactga 318
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctccttg 1474
|||||||| |||| || ||||||||||| || || || || |||||||| || |||||
Sbjct: 317 tcataaatgtctcttttntcaggatcactaagtacntcgtaggcctgagcaagttcctta 258
Query: 1475 aacttctcgggatcgccgcccttgtcggggtggttcttgatggcggcctt 1524
||||| || ||||| || |||||||| || ||||| ||||| || |||||
Sbjct: 257 aacttttctggatctccacccttgtccggatggtttttgatagcagcctt 208
>gb|BI397729.1|BI397729 NXPV_104_F04_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_104_F04 5' similar to Arabidopsis
thaliana sequence At3g44110 dnaJ protein homolog atj3 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 478
Score = 83.8 bits (42), Expect = 2e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 391 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctcccnt 332
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 331 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 272
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 271 ccacccttatcagggtgatttttgatggc 243
>gb|BX252596.1|BX252596 BX252596 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP067C06 similar to DNAJ PROTEIN, mRNA
sequence
Length = 659
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||| ||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 395 ccacctcctcccatcccctctttcagggcatcttctccatactgatcatatatctccctt 336
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 335 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 276
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| |||||||| ||||| || ||||||||
Sbjct: 275 ccacccttgtcagggtgatttttgatggc 247
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 557 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 505
>gb|BX252900.1|BX252900 BX252900 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP074F04 similar to DNAJ PROTEIN, mRNA
sequence
Length = 443
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||| ||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 394 ccacctcctcccatcccctctttcagggcatcttctccatactgatcatatatctccctt 335
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 334 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 275
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| |||||||| ||||| || ||||||||
Sbjct: 274 ccacccttgtcagggtgatttttgatggc 246
>gb|BE123609.1|BE123609 NXNV_146_C11_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_146_C11 5' similar to Arabidopsis thaliana sequence
At5g22060 DNAJ PROTEIN HOMOLOG ATJ see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 306
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 178 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 119
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 118 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 59
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 58 ccacccttatcagggtgatttttgatggc 30
>gb|CF390139.1|CF390139 RTDR2_12_E04.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_12_E04_A021 5', mRNA
sequence
Length = 674
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 340 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 281
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 280 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 221
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 220 ccacccttatcagggtgatttttgatggc 192
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 502 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 450
>gb|CF473550.1|CF473550 RTWW2_3_H01.g1_A021 Well-watered loblolly pine roots WW2 Pinus taeda
cDNA clone RTWW2_3_H01_A021 5', mRNA sequence
Length = 702
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 370 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 311
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 310 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 251
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 250 ccacccttatcagggtgatttttgatggc 222
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 532 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 480
>gb|CF669350.1|CF669350 RTCNT1_42_F05.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_42_F05_A029 5', mRNA sequence
Length = 656
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 405 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 346
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 345 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 286
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 285 ccacccttatcagggtgatttttgatggc 257
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 567 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 515
>gb|CO368425.1|CO368425 RTK1_40_C07.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_40_C07_A029 5', mRNA sequence
Length = 813
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 382 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 323
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 322 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 263
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 262 ccacccttatcagggtgatttttgatggc 234
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 544 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 492
>gb|CV033295.1|CV033295 RTNACL1_33_D06.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_33_D06_A029 5', mRNA sequence
Length = 600
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 409 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 350
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 349 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 290
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 289 ccacccttatcagggtgatttttgatggc 261
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 571 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 519
>gb|CX651299.1|CX651299 COLD1_51_A08.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_51_A08_A029 5', mRNA sequence
Length = 516
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 352 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 293
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 292 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 233
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 232 ccacccttatcagggtgatttttgatggc 204
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 514 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 462
>gb|DR060009.1|DR060009 RTNIT1_25_D07.b1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_25_D07_A029 3', mRNA sequence
Length = 802
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Plus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 432 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 491
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 492 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 551
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 552 ccacccttatcagggtgatttttgatggc 580
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 270 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 322
>gb|DR089543.1|DR089543 RTAL1_9_H03.b1_A029 Roots plus added aluminum Pinus taeda cDNA clone
RTAL1_9_H03_A029 3', mRNA sequence
Length = 768
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Plus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 382 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 441
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 442 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 501
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 502 ccacccttatcagggtgatttttgatggc 530
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 220 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 272
>gb|DR163547.1|DR163547 RTFE1_43_C01.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_43_C01_A029 5', mRNA sequence
Length = 821
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 369 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 310
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 309 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 250
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 249 ccacccttatcagggtgatttttgatggc 221
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 531 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 479
>gb|DR182342.1|DR182342 RTMNUT1_44_A01.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_44_A01_A029 5', mRNA sequence
Length = 695
Score = 81.8 bits (41), Expect = 8e-014
Identities = 122/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 360 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 301
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 300 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 241
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 240 ccacccttatcagggtgatttttgatggc 212
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 522 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 470
>gb|DR177127.1|DR177127 RTMNUT1_3_G04.b1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_3_G04_A029 3', mRNA sequence
Length = 573
Score = 79.8 bits (40), Expect = 3e-013
Identities = 162/201 (80%), Gaps = 4/201 (1%)
Strand = Plus / Plus
Query: 1325 ccaccaaagaatgactggaatatgtcaaagggatcgtgcatccctccaccacctcccatt 1384
||||||||||| ||||||||||| ||||| ||||| || || || || || ||||||
Sbjct: 2 ccaccaaagaacgactggaatatatcaaatggatcatga---ccgccgccgccacccatt 58
Query: 1385 ccctccttgagggcatcctcaccatat-tgatcataaatctctcgcttttcaggatcact 1443
|| || ||||| |||||||| || || ||||||||||| |||| || |||||||||||
Sbjct: 59 ccttctttgagtgcatcctccccgtanctgatcataaatgtctcttttctcaggatcact 118
Query: 1444 gaggacctcataagcctgagctagctccttgaacttctcgggatcgccgcccttgtcggg 1503
|| ||||| || |||||||| || ||||| ||||| || ||||| || |||||||| ||
Sbjct: 119 aagtacctcgtaggcctgagcaagttccttaaacttttctggatctccacccttgtccgg 178
Query: 1504 gtggttcttgatggcggcctt 1524
||||| ||||| || |||||
Sbjct: 179 atggtttttgatagcagcctt 199
>gb|BM427813.1|BM427813 NXRV_003_F06_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_003_F06 5' similar to Arabidopsis thaliana
sequence At3g44110 dnaJ protein homolog atj3 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 578
Score = 77.8 bits (39), Expect = 1e-012
Identities = 119/146 (81%)
Strand = Plus / Minus
Query: 1379 cccattccctccttgagggcatcctcaccatattgatcataaatctctcgcttttcagga 1438
||||||| || ||||| |||||||| || || ||||||||||| |||| || ||||||
Sbjct: 419 cccattcnttctttgagtgcatcctccccgtactgatcataaatgtctcttttctcagga 360
Query: 1439 tcactgaggacctcataagcctgagctagctccttgaacttctcgggatcgccgcccttg 1498
||||| || ||||| || |||||||| || ||||| ||||| || ||||| || ||||||
Sbjct: 359 tcactaagtacctcgtaggcctgagcaagttccttaaacttttctggatctccacccttg 300
Query: 1499 tcggggtggttcttgatggcggcctt 1524
|| || ||||| ||||| || |||||
Sbjct: 299 tccggatggtttttgatagcagcctt 274
>gb|AW064596.1|AW064596 ST33D09 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST33D09, mRNA sequence
Length = 591
Score = 75.8 bits (38), Expect = 5e-012
Identities = 121/149 (81%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| ||||||||||| || || |||||||| || ||||| |||||||| ||||| |
Sbjct: 422 ccacctcctcccattccntctttcagggcatcttctccatactgatcatatatctccctt 363
Query: 1430 ttttcaggatcactgaggacctcataagcctgagctagctccttgaacttctcgggatcg 1489
||||| |||||||| | ||| |||||||||||||| | || ||||| || || |||||
Sbjct: 362 ttttctggatcactcaagacttcataagcctgagccaattctttgaatttttctggatcc 303
Query: 1490 ccgcccttgtcggggtggttcttgatggc 1518
|| ||||| || ||||| || ||||||||
Sbjct: 302 ccacccttatcagggtgatttttgatggc 274
Score = 46.1 bits (23), Expect = 0.005
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 1220 ccattgtacaaatcctccagagaaacctttagaggatg 1257
|||||||||| |||||||||||| |||| ||||||||
Sbjct: 576 ccattgtacaggtcctccagagaanccttcagaggatg 539
>gb|BX681362.1|BX681362 BX681362 RS Pinus pinaster cDNA clone RS57F06, mRNA sequence
Length = 611
Score = 69.9 bits (35), Expect = 3e-010
Identities = 145/179 (81%), Gaps = 7/179 (3%)
Strand = Plus / Minus
Query: 1295 ctgctgccaccacctccaaaagggcttccaccaccaaagaatgactggaatatgtcaaag 1354
||||||| ||||||||||||||| ||||||| ||||| ||||||||||| |||||
Sbjct: 172 ctgctgctaccacctccaaaaggatttccaccg---aagaacgactggaatatatcaaat 116
Query: 1355 ggatcgtgcatccctccaccacctcccattccctccttgagggcatcctcaccatattga 1414
||||| || || || || || |||||||| || ||||| |||||||| || || |||
Sbjct: 115 ggatcatga---ccgccgccgccacccattccttctttgagtgcatcctccccgtactga 59
Query: 1415 tcataaatctctcgcttttcaggatcactgaggacctcataagcctgagctagctcctt 1473
|||||||| |||| || ||||||||||| | ||||||||| |||||||| || |||||
Sbjct: 58 tcataaatgtctcttttctcaggatcact-aagacctcataggcctgagcaagttcctt 1
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 980 actttatcacctttgcattgtgggcatctatc 1011
||||| ||||| ||||||||||||||||||||
Sbjct: 487 actttttcacccttgcattgtgggcatctatc 456
Score = 40.1 bits (20), Expect = 0.28
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 1148 ccagactttgaacccttaccattgcacttggagcagagaacactgcgggacagagagagc 1207
||||||||||| || || || ||||| || ||||| |||||| | || || || || | |
Sbjct: 319 ccagactttgaccctttccccttgcatttagagcacagaacatttcgagatagtgacaac 260
Query: 1208 ttctttgatgtgccattgta 1227
||||||||||| ||||||||
Sbjct: 259 ttctttgatgttccattgta 240
>gb|CO364076.1|CO364076 RTK1_13_C01.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_13_C01_A029 5', mRNA sequence
Length = 902
Score = 69.9 bits (35), Expect = 3e-010
Identities = 80/95 (84%)
Strand = Plus / Minus
Query: 1370 ccaccacctcccattccctccttgagggcatcctcaccatattgatcataaatctctcgc 1429
||||| |||||||||||||| || |||||||| || ||||| |||||||| ||||| |
Sbjct: 132 ccacctcctcccattccctctttcagggcatcttctccatactgatcatatatctccctt 73
Query: 1430 ttttcaggatcactgaggacctcataagcctgagc 1464
||||| |||||||| | ||| ||||||||| ||||
Sbjct: 72 ttttctggatcactcaagacttcataagccagagc 38
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1214 gatgtgccattgtacaaatcctccagagaaacctttagaggatgaaccacatc 1266
||||| |||||||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 294 gatgttccattgtacaggtcctccagagaaaccttcagaggatgtacaacatc 242
>gb|CF393694.1|CF393694 RTDR3_15_G07.g1_A022 Loblolly pine roots recovering from drought DR3
Pinus taeda cDNA clone RTDR3_15_G07_A022 5', mRNA
sequence
Length = 735
Score = 65.9 bits (33), Expect = 5e-009
Identities = 54/61 (88%)
Strand = Plus / Minus
Query: 1400 tcctcaccatattgatcataaatctctcgcttttcaggatcactgaggacctcataagcc 1459
||||| ||||||||||||||||| | |||||||||| |||||| || ||||||||||||
Sbjct: 419 tcctctccatattgatcataaatagcacgcttttcagaatcactaagaacctcataagcc 360
Query: 1460 t 1460
|
Sbjct: 359 t 359
>gb|DR050649.1|DR050649 RTBOR1_24_G09.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_24_G09_A029 5', mRNA sequence
Length = 780
Score = 65.9 bits (33), Expect = 5e-009
Identities = 54/61 (88%)
Strand = Plus / Minus
Query: 1400 tcctcaccatattgatcataaatctctcgcttttcaggatcactgaggacctcataagcc 1459
||||| ||||||||||||||||| | |||||||||| |||||| || ||||||||||||
Sbjct: 498 tcctctccatattgatcataaatagcacgcttttcagaatcactaagaacctcataagcc 439
Query: 1460 t 1460
|
Sbjct: 438 t 438
>gb|DR117717.1|DR117717 RTMG1_8_E10.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_8_E10_A029 5', mRNA sequence
Length = 825
Score = 65.9 bits (33), Expect = 5e-009
Identities = 54/61 (88%)
Strand = Plus / Minus
Query: 1400 tcctcaccatattgatcataaatctctcgcttttcaggatcactgaggacctcataagcc 1459
||||| ||||||||||||||||| | |||||||||| |||||| || ||||||||||||
Sbjct: 306 tcctctccatattgatcataaatagcacgcttttcagaatcactaagaacctcataagcc 247
Query: 1460 t 1460
|
Sbjct: 246 t 246
>gb|DR682369.1|DR682369 EST1072444 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAA944 3' end, mRNA sequence
Length = 753
Score = 65.9 bits (33), Expect = 5e-009
Identities = 54/61 (88%)
Strand = Plus / Minus
Query: 1400 tcctcaccatattgatcataaatctctcgcttttcaggatcactgaggacctcataagcc 1459
||||| ||||||||||||||||| | |||||||||| |||||| || ||||||||||||
Sbjct: 356 tcctctccatattgatcataaatagcacgcttttcagaatcactaagaacctcataagcc 297
Query: 1460 t 1460
|
Sbjct: 296 t 296
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 207,162
Number of Sequences: 355925
Number of extensions: 207162
Number of successful extensions: 62297
Number of sequences better than 0.5: 191
Number of HSP's better than 0.5 without gapping: 191
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61385
Number of HSP's gapped (non-prelim): 856
length of query: 1629
length of database: 217,277,237
effective HSP length: 20
effective length of query: 1609
effective length of database: 210,158,737
effective search space: 338145407833
effective search space used: 338145407833
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)